A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: AM0006Publication date: 02/93
PMID: 8388400GI: 330756 Taxonomy ID: 10320
Virus Name: Bovine herpesvirus 1, BHV-1Product size (PCR):
bp
MgCl2: N/A mMdNTPs: mMType: PCR
Temp (PCR cycle):(95C 1min>56C 1min>73C 1min)*35
Buffer: 1 X Reaction buffer(Perkin-Elmer)
Polymerase: 4U/microL Taq Poly(Perkin-Elmer)Cycler:
Note: The primers were repeated using Whitbeck's method.(PMID:2841484) PCR was carried out according to the following protocol: 1mM P1, 1mM P2, 1microL DNA BHV-1(phenol-chloroform extraction from virions of BHV-1, titer 10^7 TCID50/ml) and 0,5,10,20 microL glycerol diluted with water 1:1 total reaction volume 50microL were added. Mixture was heated to 100C 8min, then chilled in ice before PCR.
Forward(AM00061) primer
Oligo type: PCRDegeneracy: 1
Target: 1007-1028Tm: 78.5 C at salt 1000.0mMLength:
Sequence: CACGGACCTGGTGGACAAGAAG
(4 other experimental conditions)
Note:
Reverse(AM00062) primer
Oligo type: PCRDegeneracy: 1
Target: 1473-1452Tm: 78.5 C at salt 1000.0mMLength:
Sequence: CTACCGTCACGTGCTGTGTACG
(2 other experimental conditions)
Note:
Forward(AM00063) primer
Oligo type:
Degeneracy: 1
Target: 865-885Tm: 82.2 C at salt 1000.0mMLength:
Sequence: GTACGGGTACACCGAGCGCGC
(1 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.