A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(VW00244) primer
Oligo ID:VW00243
Oligo type: PCR Denegeracy: 1
Target: 6468-6448 Tm: 64.6 C at salt 1000.0mMLength: 21
Sequence: TTTGTTATAGGCATATCATTG
(2 other experimental conditions)
Note: HRSV specific primer. Derived from [GI:9629198].

Experimental condition used for the oligonucleotide

Common Data ID: VW0024 Publication date: 07/93
PMID: 8373845 GI: 210828 Taxonomy ID:150548
Virus Name: Bovine respiratory syncytial virus A51908, BRSV, Human respiratory syncytial virus (subgroup A / strain Long), HRSV Product size (PCR):
bp
MgCl2: N/A mM dNTPs: N/A mM Type: RT-PCR
Temp (PCR cycle):95C 30sec>(95C 15sec>60C 15sec)*35>60C 105sec
Buffer: N/A
Polymerase: N/ACycler: GeneAmp PCR System 9600 (Perkin Elmer)
Note: HRSV specific primer. Derived from [GI:9629198].



Oligonucleotide information
Reverse(VW00244) primer
Oligo ID:VW00243
Oligo type: PCR Denegeracy: 1
Target: 6468-6448 Tm: 64.6 C at salt 1000.0mMLength: 21
Sequence: TTTGTTATAGGCATATCATTG
(2 other experimental conditions)
Note: HRSV specific primer. Derived from [GI:9629198].

Experimental condition used for the oligonucleotide

Common Data ID: BM1232 Publication date: 09/95
PMID: 7675483 GI: 9629198 Taxonomy ID:11250
Virus Name: Human respiratory syncytial virus Product size (PCR): 243 bp
MgCl2: 4.0 mM dNTPs: 1.0 mM Type: RT-PCR
Temp (PCR cycle):20C 20min>43C 15min>99C 5min>(94C 60sec>43C 90sec>72C 90sec)*35
Buffer: 100mM Tris-HCl (pH 8.3), 500mM KCl, 1U/microL RNAase inhibitor, 2.5U/microL RTase
Polymerase: 0.024U/microL AmpliTaq DNA polyCycler:
Note: HRSV specific primer. Derived from [GI:9629198].



Oligonucleotide information
Reverse(VW00244) primer
Oligo ID:vw00243
Oligo type: Denegeracy: 1
Target: 6468-6448 Tm: 64.6 C at salt 1000.0mMLength: 21
Sequence: TTTGTTATAGGCATATCATTG
(2 other experimental conditions)
Note: HRSV specific primer. Derived from [GI:9629198].

Experimental condition used for the oligonucleotide

Common Data ID: VW0024 Publication date: 07/93
PMID: 8373845 GI: 210828 Taxonomy ID:150548
Virus Name: Bovine respiratory syncytial virus A51908, BRSV, Human respiratory syncytial virus (subgroup A / strain Long), HRSV Product size (PCR):
bp
MgCl2: N/A mM dNTPs: N/A mM Type: RT-PCR
Temp (PCR cycle):95C 30sec>(95C 15sec>60C 15sec)*35>60C 105sec
Buffer: N/A
Polymerase: N/ACycler: GeneAmp PCR System 9600 (Perkin Elmer)
Note: HRSV specific primer. Derived from [GI:9629198].



Oligonucleotide information
Reverse(VW00244) primer
Oligo ID:vw00243
Oligo type: Denegeracy: 1
Target: 6468-6448 Tm: 64.6 C at salt 1000.0mMLength: 21
Sequence: TTTGTTATAGGCATATCATTG
(2 other experimental conditions)
Note: HRSV specific primer. Derived from [GI:9629198].

Experimental condition used for the oligonucleotide

Common Data ID: BM1232 Publication date: 09/95
PMID: 7675483 GI: 9629198 Taxonomy ID:11250
Virus Name: Human respiratory syncytial virus Product size (PCR): 243 bp
MgCl2: 4.0 mM dNTPs: 1.0 mM Type: RT-PCR
Temp (PCR cycle):20C 20min>43C 15min>99C 5min>(94C 60sec>43C 90sec>72C 90sec)*35
Buffer: 100mM Tris-HCl (pH 8.3), 500mM KCl, 1U/microL RNAase inhibitor, 2.5U/microL RTase
Polymerase: 0.024U/microL AmpliTaq DNA polyCycler:
Note: HRSV specific primer. Derived from [GI:9629198].



Oligonucleotide information
Reverse(RSV-2) primer
Oligo ID:TA006402
Oligo type: Reverse Primer Denegeracy: 1
Target: 6434-6414 Tm: 64.6C at salt 1000.0 mMLength: 21
Sequence: TTTGTTATAGGCATATCATTG
(2 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: TA0064 Publication date: 97/12
PMID: 9407385 GI: 9629367 Taxonomy ID:12814
Virus Name: Respiratory syncytial virus Product size (PCR): 243 bp
MgCl2: 2 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):(94C 30sec>47C 40sec>72 30sec)*40>72C 10min
Buffer: 10mM Tris-HCl (pH 8.3), 50mM KCl
Polymerase: 0.04U/microL Taq polyCycler:
Note:

Total 5 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.