A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(VW00243) primer
Oligo ID:VW00242
Oligo type: PCR Denegeracy: 1
Target: 6227-6246 Tm: 65.8 C at salt 1000.0mMLength: 20
Sequence: TTAACCAGCAAAGTGTTAGA
(6 other experimental conditions)
Note: HRSV specific primer. Derived from [GI:9629198].

Experimental condition used for the oligonucleotide

Common Data ID: VW0024 Publication date: 07/93
PMID: 8373845 GI: 210828 Taxonomy ID:150548
Virus Name: Bovine respiratory syncytial virus A51908, BRSV, Human respiratory syncytial virus (subgroup A / strain Long), HRSV Product size (PCR):
bp
MgCl2: N/A mM dNTPs: N/A mM Type: RT-PCR
Temp (PCR cycle):95C 30sec>(95C 15sec>60C 15sec)*35>60C 105sec
Buffer: N/A
Polymerase: N/ACycler: GeneAmp PCR System 9600 (Perkin Elmer)
Note: HRSV specific primer. Derived from [GI:9629198].



Oligonucleotide information
Forward(VW00243) primer
Oligo ID:VW00242
Oligo type: PCR Denegeracy: 1
Target: 6227-6246 Tm: 65.8 C at salt 1000.0mMLength: 20
Sequence: TTAACCAGCAAAGTGTTAGA
(6 other experimental conditions)
Note: HRSV specific primer. Derived from [GI:9629198].

Experimental condition used for the oligonucleotide

Common Data ID: BM1232 Publication date: 09/95
PMID: 7675483 GI: 9629198 Taxonomy ID:11250
Virus Name: Human respiratory syncytial virus Product size (PCR): 243 bp
MgCl2: 4.0 mM dNTPs: 1.0 mM Type: RT-PCR
Temp (PCR cycle):20C 20min>43C 15min>99C 5min>(94C 60sec>43C 90sec>72C 90sec)*35
Buffer: 100mM Tris-HCl (pH 8.3), 500mM KCl, 1U/microL RNAase inhibitor, 2.5U/microL RTase
Polymerase: 0.024U/microL AmpliTaq DNA polyCycler:
Note: HRSV specific primer. Derived from [GI:9629198].



Oligonucleotide information
Forward(RSV 2) primer
Oligo ID:PS00019
Oligo type: Denegeracy: 1
Target: 6193-6212 Tm: 65.8 C at salt 1000.0mMLength: 20
Sequence: TTAACCAGCAAAGTGTTAGA
(6 other experimental conditions)
Note: Specific to F1 subunit of the fusion glycoprotein gene of RSV.

Experimental condition used for the oligonucleotide

Common Data ID: SK0048 Publication date: 01/99
PMID: 9854054 GI: 9629367 Taxonomy ID:11250
Virus Name: Human respiratory syncytial virus ,RSV; Human parainfluenza virus 1, PIV-1; Human parainfluenza virus 3, PIV-3; Enterovirus; Influenza A virus, IFVA; Influenza B virus, IFVB; Adenovirus Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-Multiplex PCR
Temp (PCR cycle):94C 9.5min>(94C 30sec>50C 30sec>72C 30sec)*40>72C 6.5min
Buffer: 20mM Tris-HCl (pH 8.3), 56mM KCl, 0.001% gelatin, 0.01mM digoxigenin-11-dUTP (Boehringer-Mannheim)
Polymerase: 0.0625U/microL AmpliTaq Gold poly (Perkin-Elmer)Cycler: PE 9400 Thermocycler (Perkin-Elmer)
Note: Specific to F1 subunit of the fusion glycoprotein gene of RSV.



Oligonucleotide information
Forward(RSVBP2) primer
Oligo ID:PJ00329
Oligo type: Denegeracy: 1
Target: 6193-6212 Tm: 65.8 C at salt 1000.0mMLength: 20
Sequence: TTAACCAGCAAAGTGTTAGA
(6 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0533 Publication date: 12/01
PMID: 11679253 GI: 9629367 Taxonomy ID:11250
Virus Name: human respiratory syncytial virus; Human parainfluenza virus 1; Human parainfluenza virus 3; Human rhinovirus 2; Influenza B virus (B/Guangdong/05/94) Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT multiplex PCR
Temp (PCR cycle):95C 5min>(94C 30sec>50C 30sec>72C 30sec)*40
Buffer: 10mM Tris-HCl (pH 8.3), 50mM KCl
Polymerase: 0.0625U/microL AmpliTaq Gold DNA poly (Perkin-Elmer)Cycler: Hybaid PCR Express Thermocycler
Note:



Oligonucleotide information
Forward(VW00243) primer
Oligo ID:vw00242
Oligo type: Denegeracy: 1
Target: 6227-6246 Tm: 65.8 C at salt 1000.0mMLength: 20
Sequence: TTAACCAGCAAAGTGTTAGA
(6 other experimental conditions)
Note: HRSV specific primer. Derived from [GI:9629198].

Experimental condition used for the oligonucleotide

Common Data ID: VW0024 Publication date: 07/93
PMID: 8373845 GI: 210828 Taxonomy ID:150548
Virus Name: Bovine respiratory syncytial virus A51908, BRSV, Human respiratory syncytial virus (subgroup A / strain Long), HRSV Product size (PCR):
bp
MgCl2: N/A mM dNTPs: N/A mM Type: RT-PCR
Temp (PCR cycle):95C 30sec>(95C 15sec>60C 15sec)*35>60C 105sec
Buffer: N/A
Polymerase: N/ACycler: GeneAmp PCR System 9600 (Perkin Elmer)
Note: HRSV specific primer. Derived from [GI:9629198].



Oligonucleotide information
Forward(VW00243) primer
Oligo ID:vw00242
Oligo type: Denegeracy: 1
Target: 6227-6246 Tm: 65.8 C at salt 1000.0mMLength: 20
Sequence: TTAACCAGCAAAGTGTTAGA
(6 other experimental conditions)
Note: HRSV specific primer. Derived from [GI:9629198].

Experimental condition used for the oligonucleotide

Common Data ID: BM1232 Publication date: 09/95
PMID: 7675483 GI: 9629198 Taxonomy ID:11250
Virus Name: Human respiratory syncytial virus Product size (PCR): 243 bp
MgCl2: 4.0 mM dNTPs: 1.0 mM Type: RT-PCR
Temp (PCR cycle):20C 20min>43C 15min>99C 5min>(94C 60sec>43C 90sec>72C 90sec)*35
Buffer: 100mM Tris-HCl (pH 8.3), 500mM KCl, 1U/microL RNAase inhibitor, 2.5U/microL RTase
Polymerase: 0.024U/microL AmpliTaq DNA polyCycler:
Note: HRSV specific primer. Derived from [GI:9629198].



Oligonucleotide information
Forward(SG008901) primer
Oligo ID:SG008901
Oligo type: Forward Primer Denegeracy: 1
Target: 2004-2023 Tm: 65.9C at salt 1000.0 mMLength: 20
Sequence: TTAACCAGCAAAGTGTTAGA
(6 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0089 Publication date: 2004
PMID: 15125873 GI: 21729393 Taxonomy ID:11250
Virus Name: Human respiratory syncytial virus Product size (PCR): bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: Multiplex RT-PCR
Temp (PCR cycle):94C 600sec>(94C 30sec>50C 30sec>72C 30sec)*38>72C 420sec
Buffer: 10 mM Tris-HCl (pH 8.3)
Polymerase: 5U AmpliTaq-Gold poly (Perkin-Elmer)Cycler: GeneAmp PCR System 9600 (Perkin-Elmer)
Note:



Oligonucleotide information
Forward(RSV-1) primer
Oligo ID:TA006401
Oligo type: Forward Primer Denegeracy: 1
Target: 6193-6212 Tm: 65.9C at salt 1000.0 mMLength: 20
Sequence: TTAACCAGCAAAGTGTTAGA
(6 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: TA0064 Publication date: 97/12
PMID: 9407385 GI: 9629367 Taxonomy ID:12814
Virus Name: Respiratory syncytial virus Product size (PCR): 243 bp
MgCl2: 2 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):(94C 30sec>47C 40sec>72 30sec)*40>72C 10min
Buffer: 10mM Tris-HCl (pH 8.3), 50mM KCl
Polymerase: 0.04U/microL Taq polyCycler:
Note:



Oligonucleotide information
Forward(RSV-1) primer
Oligo ID:TA006401
Oligo type: Forward Primer Denegeracy: 1
Target: 6193-6212 Tm: 65.9C at salt 1000.0 mMLength: 20
Sequence: TTAACCAGCAAAGTGTTAGA
(6 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: TA0065 Publication date: 97/12
PMID: 9407385 GI: 9629367 Taxonomy ID:12814
Virus Name: Respiratory syncytial virus Product size (PCR): 176 bp
MgCl2: 1.8 mM dNTPs: 0.18 mM Type: Nested RT-PCR
Temp (PCR cycle):(94C 30sec>52C 40sec>72C 10min)*35
Buffer: 9mM Tris-HCl (pH 8.3), 45mM KCl
Polymerase: 0.036U/microL Taq PolyCycler:
Note:



Oligonucleotide information
Forward(RSV-1) primer
Oligo ID:TA006401
Oligo type: Forward Primer Denegeracy: 1
Target: 6193-6212 Tm: 65.9C at salt 1000.0 mMLength: 20
Sequence: TTAACCAGCAAAGTGTTAGA
(6 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: TA0064 Publication date: 97/12
PMID: 9407385 GI: 9629367 Taxonomy ID:12814
Virus Name: Respiratory syncytial virus Product size (PCR): 243 bp
MgCl2: 2 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):(94C 30sec>47C 40sec>72 30sec)*40>72C 10min
Buffer: 10mM Tris-HCl (pH 8.3), 50mM KCl
Polymerase: 0.04U/microL Taq polyCycler:
Note:



Oligonucleotide information
Forward(RSV-1) primer
Oligo ID:TA006401
Oligo type: Forward Primer Denegeracy: 1
Target: 6193-6212 Tm: 65.9C at salt 1000.0 mMLength: 20
Sequence: TTAACCAGCAAAGTGTTAGA
(6 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: TA0065 Publication date: 97/12
PMID: 9407385 GI: 9629367 Taxonomy ID:12814
Virus Name: Respiratory syncytial virus Product size (PCR): 176 bp
MgCl2: 1.8 mM dNTPs: 0.18 mM Type: Nested RT-PCR
Temp (PCR cycle):(94C 30sec>52C 40sec>72C 10min)*35
Buffer: 9mM Tris-HCl (pH 8.3), 45mM KCl
Polymerase: 0.036U/microL Taq PolyCycler:
Note:

Total 11 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.