A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(BNITMSARP) primer
Oligo ID:UM00202
Oligo type:
Denegeracy: 1
Target: 18218-18241 Tm: 77 C at salt 1000.0mMLength: 24
Sequence: TCGTGCGTGGATTGGCTTTGATGT
(2 other experimental conditions)
Note: 5' end conjugated with 6-carboxyfluorescein, 3' end with 6-carboxy-N,N,N',N'-tetramethylrhodamin
Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: UM0020 Publication date: 8/2003
PMID: 12690091 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS Coronavirus Product size (PCR): 77 bp
MgCl2: N/A mM dNTPs: N/A mM Type: Real-time PCR
Temp (PCR cycle):45C 15min>95C 3min>(95C 10sec>58C 30sec)*40
Buffer: Superscript II reverse transcriptase (RT)/platinum Taq polymerase one-step RT-PCR kit (Invitrogen).
Polymerase: Platinum Taq polCycler: N/A
Note: 5' end conjugated with 6-carboxyfluorescein, 3' end with 6-carboxy-N,N,N',N'-tetramethylrhodamin
Target range from sequence.



Oligonucleotide information
Forward(BNITMSARP) primer
Oligo ID:UM00202
Oligo type:
Denegeracy: 1
Target: 18218-18241 Tm: 77 C at salt 1000.0mMLength: 24
Sequence: TCGTGCGTGGATTGGCTTTGATGT
(2 other experimental conditions)
Note: 5' end conjugated with 6-carboxyfluorescein, 3' end with 6-carboxy-N,N,N',N'-tetramethylrhodamin
Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: SG0144 Publication date: 05/05
PMID: 15131175 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS Coronavirus Product size (PCR): 80 bp
MgCl2: mM dNTPs: mM Type: Q-RT-PCR
Temp (PCR cycle):95C 10sec>(95C 2sec>55C 12sec>72C10sec)*50>40C 30sec
Buffer:
Polymerase: Cycler:
Note: 5' end conjugated with 6-carboxyfluorescein, 3' end with 6-carboxy-N,N,N',N'-tetramethylrhodamin
Target range from sequence.



Oligonucleotide information
Forward(BNI-TMSARP) primer
Oligo ID:SG007503
Oligo type: PCR Probe Denegeracy: 1
Target: 18218-18241 Tm: 77C at salt 1000.0 mMLength: 24
Sequence: TCGTGCGTGGATTGGCTTTGATGT
(2 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0075 Publication date: 03/04
PMID: 15109406 GI: 37960831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 77 bp
MgCl2: mM dNTPs: mM Type: Real-time RT-PCR
Temp (PCR cycle):
Buffer: 1X Buffer
Polymerase: 0.6microL Taq polyCycler:
Note:



Oligonucleotide information
Forward(BNITMSARP) primer
Oligo ID:um00202
Oligo type:
Denegeracy: 1
Target: 18218-18241 Tm: 77 C at salt 1000.0mMLength: 24
Sequence: TCGTGCGTGGATTGGCTTTGATGT
(2 other experimental conditions)
Note: 5' end conjugated with 6-carboxyfluorescein, 3' end with 6-carboxy-N,N,N',N'-tetramethylrhodamin
Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: UM0020 Publication date: 8/2003
PMID: 12690091 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS Coronavirus Product size (PCR): 77 bp
MgCl2: N/A mM dNTPs: N/A mM Type: Real-time PCR
Temp (PCR cycle):45C 15min>95C 3min>(95C 10sec>58C 30sec)*40
Buffer: Superscript II reverse transcriptase (RT)/platinum Taq polymerase one-step RT-PCR kit (Invitrogen).
Polymerase: Platinum Taq polCycler: N/A
Note: 5' end conjugated with 6-carboxyfluorescein, 3' end with 6-carboxy-N,N,N',N'-tetramethylrhodamin
Target range from sequence.



Oligonucleotide information
Forward(BNITMSARP) primer
Oligo ID:um00202
Oligo type:
Denegeracy: 1
Target: 18218-18241 Tm: 77 C at salt 1000.0mMLength: 24
Sequence: TCGTGCGTGGATTGGCTTTGATGT
(2 other experimental conditions)
Note: 5' end conjugated with 6-carboxyfluorescein, 3' end with 6-carboxy-N,N,N',N'-tetramethylrhodamin
Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: SG0144 Publication date: 05/05
PMID: 15131175 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS Coronavirus Product size (PCR): 80 bp
MgCl2: mM dNTPs: mM Type: Q-RT-PCR
Temp (PCR cycle):95C 10sec>(95C 2sec>55C 12sec>72C10sec)*50>40C 30sec
Buffer:
Polymerase: Cycler:
Note: 5' end conjugated with 6-carboxyfluorescein, 3' end with 6-carboxy-N,N,N',N'-tetramethylrhodamin
Target range from sequence.

Total 5 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.