A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(B2) primer
Oligo ID:MO00042
Oligo type: PCR Denegeracy: 1
Target: 395-375 Tm: 72.5 C at salt 1000.0mMLength: 21
Sequence: TCAACTCCATGTGCCATGTAC
(20 other experimental conditions)
Note: This primer is specific for pestivirus. The target area was specified in the article and is only for 20 base pairs

Experimental condition used for the oligonucleotide

Common Data ID: MO0004 Publication date: 01/99
PMID: 10028170 GI: 9626649 Taxonomy ID:11099
Virus Name: pestivirus type 1 BVDV Product size (PCR): 287 bp
MgCl2: 3 mM dNTPs: 0.5 mM Type: RT-PCR
Temp (PCR cycle):95C 5min>(94C 1min>57C 1min>72C 1min)*35
Buffer: 20mM tris-HCl (pH 8.4); 50mM KCl
Polymerase: 0.05 U/microL Taq poly (GIBCO BRL)Cycler:
Note: This primer is specific for pestivirus. The target area was specified in the article and is only for 20 base pairs



Oligonucleotide information
Reverse(326) primer
Oligo ID:MP00443
Oligo type: PCR Denegeracy: 1
Target: 347-327 Tm: 72.5 C at salt 1000.0mMLength: 21
Sequence: TCAACTCCATGTGCCATGTAC
(20 other experimental conditions)
Note: Used with 324 in one PCR detected virus only 10.5%, in second PCR used with UTR1 detected virus only 37%

Experimental condition used for the oligonucleotide

Common Data ID: MP0044 Publication date: 03/00
PMID: 10730955 GI: 14113964 Taxonomy ID:144353
Virus Name: bovine viral diarrhea virus, BVDV Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.23 mM Type: RT-PCR
Temp (PCR cycle):95C 4min>(95C 1min>56C 1.5min>74C 1min)*40
Buffer: 1x PCR buffer (Promega), 0.03U/microL Taq Extender (Stratagene)
Polymerase: 0.03U/microL Taq poly (Promega)Cycler: N/A
Note: Used with 324 in one PCR detected virus only 10.5%, in second PCR used with UTR1 detected virus only 37%



Oligonucleotide information
Reverse(Pest2-L) primer
Oligo ID:KS00141
Oligo type: PCR Denegeracy: 1
Target: 395-375 Tm: 72.5 C at salt 1000.0mMLength: 21
Sequence: TCAACTCCATGTGCCATGTAC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: KS0014 Publication date: 01/99
PMID: 10028179 GI: 9626649 Taxonomy ID:11099
Virus Name: pestivirus type 1, BVDV Product size (PCR):
bp
MgCl2: 2.2 mM dNTPs: 0.2 mM Type: RT-Nested PCR 1
Temp (PCR cycle):94C 3min>(94C 45sec>54C 60sec>72C 60sec)*35 >72C 7min
Buffer: 1x PCR buffer
Polymerase: 0.025U/microL AmpliTaq polyCycler:
Note:



Oligonucleotide information
Reverse(Pest2-L) primer
Oligo ID:KS00151
Oligo type: PCR Denegeracy: 1
Target: 395-375 Tm: 72.5 C at salt 1000.0mMLength: 21
Sequence: TCAACTCCATGTGCCATGTAC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: KS0015 Publication date: 01/99
PMID: 10028179 GI: 9626649 Taxonomy ID:11099
Virus Name: pestivirus type 1, BVDV Product size (PCR): 288 bp
MgCl2: 2.2 mM dNTPs: 0.2 mM Type: RT-Nested PCR 2
Temp (PCR cycle):(94C 10sec>50C 30sec>72C 30sec)*25
Buffer: 1x PCR buffer
Polymerase: 0.025U/microL AmpliTaq polyCycler:
Note:



Oligonucleotide information
Reverse(P2) primer
Oligo ID:MP00861
Oligo type: PCR Denegeracy: 1
Target: 392-372 Tm: 72.5 C at salt 1000.0mMLength: 21
Sequence: TCAACTCCATGTGCCATGTAC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0086 Publication date: 06/94
PMID: 8074863 GI: 9864638 Taxonomy ID:144353
Virus Name: bovine viral diarrhea virus, BVDV Product size (PCR): 288 bp
MgCl2: 0.85 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):(95C 1min>60C 1min)*40
Buffer: 1x Tth reaction buffer (10mM Tris-HCl, pH 8.3, 90mM KCl)
Polymerase: 0.2U/microL rTth DNA poly (Perkin-Elmer, Norwalk, CT, USA)Cycler: N/A
Note:



Oligonucleotide information
Reverse(PEST2) primer
Oligo ID:SW00451
Oligo type: PCR Denegeracy: 1
Target: 370-350 Tm: 72.5 C at salt 1000.0mMLength: 21
Sequence: TCAACTCCATGTGCCATGTAC
(20 other experimental conditions)
Note: Used with PEST1.

Experimental condition used for the oligonucleotide

Common Data ID: SW0045 Publication date: 05/93
PMID: 8388887 GI: 9626724 Taxonomy ID:11100
Virus Name: bovine viral diarrhea virus (isolate NADL); Hog cholera virus (strain Alfort); border disease virus strain 135661 Product size (PCR):
bp
MgCl2: 2.5 mM dNTPs: 0.25 mM Type: Multiplex RT-PCR
Temp (PCR cycle):(95C 15sec>62C 60sec>72C 60sec)*40
Buffer: 25mM Tris-HCl (pH 8.4), 75mM KCl
Polymerase: 0.01U/microL Taq poly (Supertaq; Stehelin, Basel, Switzerland)Cycler: Bio-med Thermocycler 60 (GBMH; Theres, Germany)
Note: Used with PEST1.



Oligonucleotide information
Reverse(PEST2) primer
Oligo ID:CW00291
Oligo type: PCR Denegeracy: 1
Target: 395-375 Tm: 72.5 C at salt 1000.0mMLength: 21
Sequence: TCAACTCCATGTGCCATGTAC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: CW0029 Publication date: 01/98
PMID: 9476225 GI: 323205 Taxonomy ID:99476
Virus Name: Bovine viral diarrhea virus-1 isolate SH9; Bovine viral diarrhea virus isolate SH11 Product size (PCR): 156 bp
MgCl2: 2.0 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):(92C 60sec>59C 30sec>72C 60sec)*30>72C 2min
Buffer: 20mM Tris-HCl (pH 8.3), 60mM KCl
Polymerase: 0.05U/microL Goldstar Taq poly (Eurogentec; Seraing, Belgium)Cycler:
Note:



Oligonucleotide information
Reverse(326) primer
Oligo ID:CW00300
Oligo type: PCR Denegeracy: 1
Target: 382-362 Tm: 72.5 C at salt 1000.0mMLength: 21
Sequence: TCAACTCCATGTGCCATGTAC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: CW0030 Publication date: 01/98
PMID: 9476225 GI: 5733833 Taxonomy ID:99476
Virus Name: Bovine viral diarrhea virus-1 isolate SH9 Product size (PCR): 288 bp
MgCl2: 2.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):(94C 1min>56C 1min>72C 1min)*35>72C 6min
Buffer: 10mM Tris-HCl (pH 9.0), 50mM KCl, 100ng/microL BSA
Polymerase: 0.02U/microL Taq poly (Perkin Elmer)Cycler:
Note:



Oligonucleotide information
Reverse(PN00247) primer
Oligo ID:PN00247
Oligo type: Denegeracy: 1
Target: 395-375 Tm: 72.5 C at salt 1000.0mMLength: 21
Sequence: TCAACTCCATGTGCCATGTAC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SK0053 Publication date: 11/00
PMID: 11042401 GI: 3661565 Taxonomy ID:11096
Virus Name: Classical swine fever virus, CSFV Product size (PCR):
bp
MgCl2: 6.0 mM dNTPs: 0.4 mM Type: RT-Nested PCR 1
Temp (PCR cycle):42C 30min>95C 3min>(94C 1min>60C 1min>72C 1min)*20
Buffer: 1x Buffer (Promega), 0.2% Triton X-100, 0.2U/microL RNAsin, 2U/microL MMLV RTase
Polymerase: 0.05U/microL Taq poly (Promega)Cycler:
Note:



Oligonucleotide information
Reverse(BVD326) primer
Oligo ID:pn00292
Oligo type: Denegeracy: 1
Target: 395-375 Tm: 72.5 C at salt 1000.0mMLength: 21
Sequence: TCAACTCCATGTGCCATGTAC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SK0064 Publication date: 11/00
PMID: 11085469 GI: 7960753 Taxonomy ID:11100
Virus Name: bovine viral diarrhea virus (isolate NADL), NADL; pestivirus type 1 strain CS8644, CS8644 Product size (PCR):
bp
MgCl2: N/A mM dNTPs: 0.2 mM Type: Universal RT-PCR
Temp (PCR cycle):50C 45min>94C 2min>50C 4min>72C 5min>(94C 0.5min>50C 2min>72C 5min)*35>72C 15min
Buffer: 20mM Tris-HCl (pH 8.8), 10mM KCl, 10mM (NH4)2SO4, 2.0mM MgSO4, 0.1% Triton X-100, 10ng/microL BSA, 5mM DTT
Polymerase: 0.02U/microL AmpliTaq DNA poly (Perkin-Elmer Biosystems)Cycler: 2400, 9600 or 9700 thermocycler (Perkin-Elmer Biosystems)
Note:



Oligonucleotide information
Reverse(PN00286) primer
Oligo ID:PN00286
Oligo type: Denegeracy: 1
Target: 395-375 Tm: 72.5 C at salt 1000.0mMLength: 21
Sequence: TCAACTCCATGTGCCATGTAC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SK0065 Publication date: 08/01
PMID: 11390104 GI: 9626649 Taxonomy ID:11099
Virus Name: Pestivirus type 1 Product size (PCR): 288 bp
MgCl2: N/A mM dNTPs: 0.3 mM Type: RT-PCR
Temp (PCR cycle):60C 30min>94C 1min>(94C 15sec>63C 40sec)*40>63C 7min
Buffer: 2.5mM Mn(OAc)2
Polymerase: 0.1U/microL rTth DNA poly (Perkin-Elmer)Cycler: GeneAmp PCR system 2400 (Perkin-Elmer)
Note:



Oligonucleotide information
Reverse(326) primer
Oligo ID:PN00408
Oligo type: Denegeracy: 1
Target: 382-362 Tm: 72.5 C at salt 1000.0mMLength: 21
Sequence: TCAACTCCATGTGCCATGTAC
(20 other experimental conditions)
Note: Article gives target as 373-353.

Experimental condition used for the oligonucleotide

Common Data ID: SK0104 Publication date: 02/99
PMID: 10068129 GI: 5733833 Taxonomy ID:11097
Virus Name: Hog cholera virus (strain Alfort); Hog cholera virus (strain Brescia); Hog cholera virus 'Switzerland 3/93/2'; bovine viral diarrhea virus (isolate NADL); Product size (PCR):
bp
MgCl2: 2.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):(95C 1min>56C 1min>72C 1min)*35
Buffer: 10mM Tris-HCl (pH 8.3), 50mM KCl
Polymerase: 0.025U/microL Taq poly (Takara)Cycler:
Note: Article gives target as 373-353.



Oligonucleotide information
Reverse(PEST2) primer
Oligo ID:pb00355
Oligo type: Denegeracy: 1
Target: 395-375 Tm: 72.5 C at salt 1000.0mMLength: 21
Sequence: TCAACTCCATGTGCCATGTAC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BH0045 Publication date: 11/97
PMID: 9491443 GI: 9626649 Taxonomy ID:11099
Virus Name: Pestivirus type 1 Product size (PCR):
bp
MgCl2: 2.5 mM dNTPs: 0.4 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>56C 1min>72C 1min)*35>72C 10min
Buffer: 10mM Tris-HCl (pH 8.3), 50mM KCl
Polymerase: 0.025U/microL AmpliTaq DNA poly (Perkin-Elmer Cetus)Cycler: Programmable Thermal Controller (MJ Research Inc)
Note:



Oligonucleotide information
Reverse(326) primer
Oligo ID:pb00365
Oligo type: Denegeracy: 1
Target: 395-375 Tm: 72.5 C at salt 1000.0mMLength: 21
Sequence: TCAACTCCATGTGCCATGTAC
(20 other experimental conditions)
Note: Specific to 5' noncoding region.

Experimental condition used for the oligonucleotide

Common Data ID: BM0050 Publication date: 04/97
PMID: 9129644 GI: 7960755 Taxonomy ID:61010
Virus Name: Border disease virus strain Moredun cp, BDV cp; Border disease virus strain Moredun ncp, BDV ncp; Hog cholera virus (strain Brescia), CSFV; bovine viral diarrhea virus (isolate NADL), BVDV NADL Product size (PCR):
bp
MgCl2: 2.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):(94C 1min>56C 1min>72C 1min)*35>72C 7min
Buffer: 10mM Tris-HCl (pH 8.3), 50mM KCl, 0.1mg/mL BSA
Polymerase: 0.02U/microL Taq poly (Perkin Elmer-Cetus)Cycler: Perkin Elmer-Cetus thermocycler
Note: Specific to 5' noncoding region.



Oligonucleotide information
Reverse(326) primer
Oligo ID:pb00382
Oligo type: Denegeracy: 1
Target: 395-375 Tm: 72.5 C at salt 1000.0mMLength: 21
Sequence: TCAACTCCATGTGCCATGTAC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0058 Publication date: 1994
PMID: 8031236 GI: 7960753 Taxonomy ID:11100
Virus Name: bovine viral diarrhea virus isolates NADL and SD-1, NADL and SD-1; Hog cholera virus strains Alfort and Brescia, Alfort and Brescia; border disease virus strains Moredun cp and Moredun ncp, Moredun CP and Moredun NCP Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):(95C 1min>56C 1min>72C 1min)*35
Buffer: 10mM Tris-HCl (pH 8.3), 50mM KCl, 0.1mg/mL gelatine
Polymerase: 0.04U/microL Taq DNA poly (Boehringer Mannheim)Cycler:
Note:



Oligonucleotide information
Reverse(primer 326) primer
Oligo ID:PL00065
Oligo type: Denegeracy: 1
Target: 395-375 Tm: 72.5 C at salt 1000.0mMLength: 21
Sequence: TCAACTCCATGTGCCATGTAC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0264 Publication date: 04/97
PMID: 9129644 GI: 7960753 Taxonomy ID:11100
Virus Name: bovine viral diarrhea virus (isolate NADL), BVDV Product size (PCR): 288 bp
MgCl2: 2.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):(94C 1min>56C 1min>72C 1min)*35>72C 7min
Buffer: 1x PCR buffer (10mM Tris-HCl, pH 9.0, 50mM KCl, 0.1mg/ml BSA)
Polymerase: 0.02U/microL Taq poly (Perkin Elmer-Cetus)Cycler: Perkin Elmer Cetus Thermocycler
Note:



Oligonucleotide information
Reverse(5NTR-2) primer
Oligo ID:PJ00092
Oligo type: Denegeracy: 1
Target: 383-363 Tm: 72.5 C at salt 1000.0mMLength: 21
Sequence: TCAACTCCATGTGCCATGTAC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0387 Publication date: 1999
PMID: 10542017 GI: 871250 Taxonomy ID:11096
Virus Name: Classical swine fever virus strain Wingene'93, CSFV Product size (PCR): N/A bp
MgCl2: 1 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 1min>(95C 45sec>55C 1min>72C 1min)*35>72C 5min
Buffer: 1x PCR buffer (Eurogentec)
Polymerase: 0.003U/microL GoldStar Poly (Eurogentec)Cycler: ABI PRISM Dye Terminatory Cycle Sequencing Ready Reaction Kit
Note:



Oligonucleotide information
Reverse(Pest2) primer
Oligo ID:PJ00134
Oligo type: Denegeracy: 1
Target: 383-363 Tm: 72.5 C at salt 1000.0mMLength: 21
Sequence: TCAACTCCATGTGCCATGTAC
(20 other experimental conditions)
Note: Article lists position at 373-353

Experimental condition used for the oligonucleotide

Common Data ID: MP0404 Publication date: 12/97
PMID: 9495535 GI: 13383931 Taxonomy ID:11096
Virus Name: Hog cholera virus (strain Alfort/Tubingen) Product size (PCR): N/A bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: Nested RT-PCR 1
Temp (PCR cycle):(94C 1min>57C 1min>72C 1min)*5>(94C 1min>52C 1min>72C 1min)*30>72C 7min
Buffer: 50mM potassium chloride, 10mM Tris HCl pH 8.3
Polymerase: 0.025U/microL Taq poly (Perkin-Elmer, Norwalk, CT)Cycler: Perkin Elmer Thermal Cycler
Note: Article lists position at 373-353



Oligonucleotide information
Reverse(Pest2) primer
Oligo ID:PJ00134
Oligo type: Denegeracy: 1
Target: 383-363 Tm: 72.5 C at salt 1000.0mMLength: 21
Sequence: TCAACTCCATGTGCCATGTAC
(20 other experimental conditions)
Note: Article lists position at 373-353

Experimental condition used for the oligonucleotide

Common Data ID: MP0405 Publication date: 12/97
PMID: 9495535 GI: 13383931 Taxonomy ID:11096
Virus Name: Hog cholera virus (strain Alfort/Tubingen) Product size (PCR): N/A bp
MgCl2: 1.5 mM dNTPs: 0.1 mM Type: Nested RT-PCR 2
Temp (PCR cycle):(94C 1min>57C 1min>72C 1min)*5>(94C 1min>52C 1min>72C 1min)*30>72C 7min
Buffer: 50mM potassium chloride, 10mM Tris HCl pH 8.3
Polymerase: 0.025U/microL Taq poly (Perkin-Elmer, Norwalk, CT)Cycler: Perkin Elmer Thermal Cycler
Note: Article lists position at 373-353



Oligonucleotide information
Reverse(Pest2) primer
Oligo ID:PJ00134
Oligo type: Denegeracy: 1
Target: 383-363 Tm: 72.5 C at salt 1000.0mMLength: 21
Sequence: TCAACTCCATGTGCCATGTAC
(20 other experimental conditions)
Note: Article lists position at 373-353

Experimental condition used for the oligonucleotide

Common Data ID: MP0404 Publication date: 12/97
PMID: 9495535 GI: 13383931 Taxonomy ID:11096
Virus Name: Hog cholera virus (strain Alfort/Tubingen) Product size (PCR): N/A bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: Nested RT-PCR 1
Temp (PCR cycle):(94C 1min>57C 1min>72C 1min)*5>(94C 1min>52C 1min>72C 1min)*30>72C 7min
Buffer: 50mM potassium chloride, 10mM Tris HCl pH 8.3
Polymerase: 0.025U/microL Taq poly (Perkin-Elmer, Norwalk, CT)Cycler: Perkin Elmer Thermal Cycler
Note: Article lists position at 373-353



Oligonucleotide information
Reverse(Pest2) primer
Oligo ID:PJ00134
Oligo type: Denegeracy: 1
Target: 383-363 Tm: 72.5 C at salt 1000.0mMLength: 21
Sequence: TCAACTCCATGTGCCATGTAC
(20 other experimental conditions)
Note: Article lists position at 373-353

Experimental condition used for the oligonucleotide

Common Data ID: MP0405 Publication date: 12/97
PMID: 9495535 GI: 13383931 Taxonomy ID:11096
Virus Name: Hog cholera virus (strain Alfort/Tubingen) Product size (PCR): N/A bp
MgCl2: 1.5 mM dNTPs: 0.1 mM Type: Nested RT-PCR 2
Temp (PCR cycle):(94C 1min>57C 1min>72C 1min)*5>(94C 1min>52C 1min>72C 1min)*30>72C 7min
Buffer: 50mM potassium chloride, 10mM Tris HCl pH 8.3
Polymerase: 0.025U/microL Taq poly (Perkin-Elmer, Norwalk, CT)Cycler: Perkin Elmer Thermal Cycler
Note: Article lists position at 373-353



Oligonucleotide information
Reverse(R) primer
Oligo ID:pj00366
Oligo type: Denegeracy: 1
Target: 395-375 Tm: 72.5 C at salt 1000.0mMLength: 21
Sequence: TCAACTCCATGTGCCATGTAC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0522 Publication date: 07/01
PMID: 11503899 GI: 9626649 Taxonomy ID:11100
Virus Name: bovine viral diarrhea virus (isolate NADL) Product size (PCR):
bp
MgCl2: 1.86 mM dNTPs: 0.2 mM Type: RT-nested PCR 1
Temp (PCR cycle):(94C 30sec>55C 100sec>72C 100sec)*30
Buffer: 16.6mM Tris-HCl, 107mM KCl, 500microg/mL BSA, 0.1% NaCl, 0.1% Triton X-100, 1.26mM DTT, 6microM EDTA, 3% glycerol
Polymerase: 0.025U/microL Tth DNA polyCycler:
Note:



Oligonucleotide information
Reverse(BVD43) primer
Oligo ID:PM00502
Oligo type: Denegeracy: 1
Target: 395-375 Tm: 72.5 C at salt 1000.0mMLength: 21
Sequence: TCAACTCCATGTGCCATGTAC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0865 Publication date: 12/02
PMID: 12421586 GI: 7960753 Taxonomy ID:11100
Virus Name: Bovine viral diarrhea virus (isolate NADL), BVDV Product size (PCR):
bp
MgCl2: 2.5 mM dNTPs: 0.2 mM Type: RT-Semi-nested PCR
Temp (PCR cycle):95C 3min>(95C 30sec>55C 30sec>72C 60sec)*25>72C 3min
Buffer: 1x reaction buffer (Promega), 0.02% BSA
Polymerase: 0.02U/microL Taq DNA poly (Promega)Cycler: PTC 200 thermal cycler (MJ Research)
Note:

Total 23 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.