Oligonucleotide information | |||||
| Reverse(PB00086) primer | |||||
| Oligo ID:pb00086 | |||||
| Oligo type: | Denegeracy: 1 | ||||
| Target: 1056-1036 | Tm: 72.5 C at salt 1000.0mM | Length: 21 | |||
| Sequence: GTTTCTCTGGTACATTCCGCA
(0 other experimental conditions) | |||||
| Note: Used with PB00085; [GI:324131]. | |||||
Experimental condition used for the oligonucleotide | |||||
| Common Data ID: SK0080 | Publication date: 02/01 | ||||
| PMID: 11158130 | GI: 324123 | Taxonomy ID:119210 | |||
| Virus Name: Influenza A virus (H3N2 subtype) | Product size (PCR): bp | ||||
| MgCl2: 1.5 mM | dNTPs: 0.2 mM | Type: RT-PCR | |||
| Temp (PCR cycle):50C 30min>94C 3min>(94C 30sec>45C 30sec>68C 120sec)*35>68C 10min | |||||
| Buffer: N/A | |||||
| Polymerase: N/A | Cycler: | ||||
| Note: Used with PB00085; [GI:324131]. | |||||
| Total 1 Oligos | |||||