A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(PB00283) primer
Oligo ID:pb00283
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note: Specific to hexon gene of adenovirus.

Experimental condition used for the oligonucleotide

Common Data ID: BM0164 Publication date: 04/99
PMID: 10194183 GI: 209811 Taxonomy ID:28285
Virus Name: Human adenovirus type 5 Product size (PCR):
bp
MgCl2: 2.5 mM dNTPs: 0.05 mM Type: Nested PCR 1
Temp (PCR cycle):94C 2min15sec>(94C 45sec>55C 30sec>72C 60sec)*40>72C 6min
Buffer: 10mM Tris-HCl (pH 8.3), 50mM KCl
Polymerase: 0.03U/microL Taq DNA poly (Gibco-BRL)Cycler: Robocycler (Stratagene)
Note: Specific to hexon gene of adenovirus.



Oligonucleotide information
Forward(PJ00429) primer
Oligo ID:PJ00429
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0460 Publication date: 07/01
PMID: 11447081 GI: 9626158 Taxonomy ID:10509
Virus Name: Mastadenovirus Product size (PCR): 308 bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 10min>(94C 90sec>60C 45sec>72C 180sec)*30
Buffer: 10mM Tris-HCl pH 8.3, 50mM KCl
Polymerase: Taq Gold poly (Perkin-Elmer)Cycler: N/A
Note:



Oligonucleotide information
Forward(PD00548) primer
Oligo ID:PD00548
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note: Primers are specific to the hexon gene

Experimental condition used for the oligonucleotide

Common Data ID: MP0475 Publication date: 05/97
PMID: 9191018 GI: 9626158 Taxonomy ID:10515
Virus Name: Human adenovirus type 2, AdV Product size (PCR): N/A bp
MgCl2: N/A mM dNTPs: N/A mM Type: PCR
Temp (PCR cycle):(94C 45sec>55C 90sec>72C 90sec)*30
Buffer: N/A
Polymerase: N/ACycler: N/A
Note: Primers are specific to the hexon gene



Oligonucleotide information
Forward(H1) primer
Oligo ID:pj00435
Oligo type: Denegeracy: 1
Target: 245-269 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0656 Publication date: 01/96
PMID: 8690766 GI: 4263018 Taxonomy ID:10515
Virus Name: Human adenovirus type 2 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: PCR
Temp (PCR cycle):94C 7min>(94C 120sec>45C 90sec>70C 120sec)*30
Buffer: 10mM Tris-HCl (pH 8.3), 50mM KCl, 10% (v/v) glycerol
Polymerase: 0.025U/microL Taq DNA poly (Boehringer Mannheim)Cycler:
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0668 Publication date: 11/98
PMID: 9774586 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenovirus Product size (PCR): 308 bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: Universal PCR
Temp (PCR cycle):94C 6min>(94C 1min>55C 1min>72C 1.5min)*41
Buffer: 10mM Tris-HCl (pH 8.3), 50mM KCl
Polymerase: 0.05U/microL Taq poly (Perkin-Elmer)Cycler: termocycler 9600 (Perkin-Elmer)
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0683 Publication date: 11/94
PMID: 7852969 GI: 209811 Taxonomy ID:10533
Virus Name: Human adenovirus Product size (PCR):
bp
MgCl2: 3.0 mM dNTPs: 0.1 mM Type: Universal PCR
Temp (PCR cycle):92C 3min>(92C 30sec>56C 30sec>72C 30sec)*30
Buffer: 50mM KCl, 10mM Tris-HCl (pH 9.0), 0.1% Triton X-100
Polymerase: 0.02U/microL Taq DNA poly (Promega)Cycler: thermal cycler (Techne)
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1159 Publication date: 05/00
PMID: 10872077 GI: 323417 Taxonomy ID:12059
Virus Name: Enterovirus; Human adenovirus Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-Nested PCR 1
Temp (PCR cycle):94C 4min>(95C 30sec>55C 30sec>72C 60sec)*35>72C 7min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton-X-100
Polymerase: 0.025U/microL Taq poly (Promega)Cycler:
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1231 Publication date: 09/95
PMID: 7675483 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenoviruses Product size (PCR): 308 bp
MgCl2: 2.0 mM dNTPs: 0.1 mM Type: Universal PCR
Temp (PCR cycle):94C 4min>(92C 30sec>45C 45sec>70C 30sec)*35
Buffer: 100mM Tris-HCl (pH 8.3), 500mM KCl
Polymerase: 0.025U/microL AmpliTaq DNA polyCycler:
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1250 Publication date: 12/94
PMID: 7699615 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenovirus Product size (PCR): 301 bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: Universal PCR
Temp (PCR cycle):(94C 45sec>55C 60sec> 72C 120sec)*35
Buffer: 10mM Tris-HCl (pH 8.3), 50mM KCl, 100ng/microL gelatin
Polymerase: 0.05U/microL Taq DNA poly (Boehringer Mannheim)Cycler:
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1283 Publication date: 08/94
PMID: 8085832 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenovirus Product size (PCR): 300 bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: Nested PCR 1
Temp (PCR cycle):37C 60min>94C 4min>(92C 90sec>55C 90sec>72C 120sec)*30
Buffer: 50mM KCl, 10mM Tris-HCl (pH 9.0), 0.01% (w/v) gelatin, 0.1% Triton X-100, 0.05U/microL UNG
Polymerase: 0.04U/microL Taq DNA poly (Promega)Cycler: programmable heat block (Coy Laboratory Products, Inc.; Ann Arbor, MI)
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1283 Publication date: 08/94
PMID: 8085832 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenovirus Product size (PCR): 300 bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: Nested PCR 1
Temp (PCR cycle):37C 60min>94C 4min>(92C 90sec>55C 90sec>72C 120sec)*30
Buffer: 50mM KCl, 10mM Tris-HCl (pH 9.0), 0.01% (w/v) gelatin, 0.1% Triton X-100, 0.05U/microL UNG
Polymerase: 0.04U/microL Taq DNA poly (Promega)Cycler: programmable heat block (Coy Laboratory Products, Inc.; Ann Arbor, MI)
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0668 Publication date: 11/98
PMID: 9774586 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenovirus Product size (PCR): 308 bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: Universal PCR
Temp (PCR cycle):94C 6min>(94C 1min>55C 1min>72C 1.5min)*41
Buffer: 10mM Tris-HCl (pH 8.3), 50mM KCl
Polymerase: 0.05U/microL Taq poly (Perkin-Elmer)Cycler: termocycler 9600 (Perkin-Elmer)
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0683 Publication date: 11/94
PMID: 7852969 GI: 209811 Taxonomy ID:10533
Virus Name: Human adenovirus Product size (PCR):
bp
MgCl2: 3.0 mM dNTPs: 0.1 mM Type: Universal PCR
Temp (PCR cycle):92C 3min>(92C 30sec>56C 30sec>72C 30sec)*30
Buffer: 50mM KCl, 10mM Tris-HCl (pH 9.0), 0.1% Triton X-100
Polymerase: 0.02U/microL Taq DNA poly (Promega)Cycler: thermal cycler (Techne)
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1159 Publication date: 05/00
PMID: 10872077 GI: 323417 Taxonomy ID:12059
Virus Name: Enterovirus; Human adenovirus Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-Nested PCR 1
Temp (PCR cycle):94C 4min>(95C 30sec>55C 30sec>72C 60sec)*35>72C 7min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton-X-100
Polymerase: 0.025U/microL Taq poly (Promega)Cycler:
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1231 Publication date: 09/95
PMID: 7675483 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenoviruses Product size (PCR): 308 bp
MgCl2: 2.0 mM dNTPs: 0.1 mM Type: Universal PCR
Temp (PCR cycle):94C 4min>(92C 30sec>45C 45sec>70C 30sec)*35
Buffer: 100mM Tris-HCl (pH 8.3), 500mM KCl
Polymerase: 0.025U/microL AmpliTaq DNA polyCycler:
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1250 Publication date: 12/94
PMID: 7699615 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenovirus Product size (PCR): 301 bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: Universal PCR
Temp (PCR cycle):(94C 45sec>55C 60sec> 72C 120sec)*35
Buffer: 10mM Tris-HCl (pH 8.3), 50mM KCl, 100ng/microL gelatin
Polymerase: 0.05U/microL Taq DNA poly (Boehringer Mannheim)Cycler:
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1283 Publication date: 08/94
PMID: 8085832 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenovirus Product size (PCR): 300 bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: Nested PCR 1
Temp (PCR cycle):37C 60min>94C 4min>(92C 90sec>55C 90sec>72C 120sec)*30
Buffer: 50mM KCl, 10mM Tris-HCl (pH 9.0), 0.01% (w/v) gelatin, 0.1% Triton X-100, 0.05U/microL UNG
Polymerase: 0.04U/microL Taq DNA poly (Promega)Cycler: programmable heat block (Coy Laboratory Products, Inc.; Ann Arbor, MI)
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1283 Publication date: 08/94
PMID: 8085832 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenovirus Product size (PCR): 300 bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: Nested PCR 1
Temp (PCR cycle):37C 60min>94C 4min>(92C 90sec>55C 90sec>72C 120sec)*30
Buffer: 50mM KCl, 10mM Tris-HCl (pH 9.0), 0.01% (w/v) gelatin, 0.1% Triton X-100, 0.05U/microL UNG
Polymerase: 0.04U/microL Taq DNA poly (Promega)Cycler: programmable heat block (Coy Laboratory Products, Inc.; Ann Arbor, MI)
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0668 Publication date: 11/98
PMID: 9774586 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenovirus Product size (PCR): 308 bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: Universal PCR
Temp (PCR cycle):94C 6min>(94C 1min>55C 1min>72C 1.5min)*41
Buffer: 10mM Tris-HCl (pH 8.3), 50mM KCl
Polymerase: 0.05U/microL Taq poly (Perkin-Elmer)Cycler: termocycler 9600 (Perkin-Elmer)
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0683 Publication date: 11/94
PMID: 7852969 GI: 209811 Taxonomy ID:10533
Virus Name: Human adenovirus Product size (PCR):
bp
MgCl2: 3.0 mM dNTPs: 0.1 mM Type: Universal PCR
Temp (PCR cycle):92C 3min>(92C 30sec>56C 30sec>72C 30sec)*30
Buffer: 50mM KCl, 10mM Tris-HCl (pH 9.0), 0.1% Triton X-100
Polymerase: 0.02U/microL Taq DNA poly (Promega)Cycler: thermal cycler (Techne)
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1159 Publication date: 05/00
PMID: 10872077 GI: 323417 Taxonomy ID:12059
Virus Name: Enterovirus; Human adenovirus Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-Nested PCR 1
Temp (PCR cycle):94C 4min>(95C 30sec>55C 30sec>72C 60sec)*35>72C 7min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton-X-100
Polymerase: 0.025U/microL Taq poly (Promega)Cycler:
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1231 Publication date: 09/95
PMID: 7675483 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenoviruses Product size (PCR): 308 bp
MgCl2: 2.0 mM dNTPs: 0.1 mM Type: Universal PCR
Temp (PCR cycle):94C 4min>(92C 30sec>45C 45sec>70C 30sec)*35
Buffer: 100mM Tris-HCl (pH 8.3), 500mM KCl
Polymerase: 0.025U/microL AmpliTaq DNA polyCycler:
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1250 Publication date: 12/94
PMID: 7699615 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenovirus Product size (PCR): 301 bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: Universal PCR
Temp (PCR cycle):(94C 45sec>55C 60sec> 72C 120sec)*35
Buffer: 10mM Tris-HCl (pH 8.3), 50mM KCl, 100ng/microL gelatin
Polymerase: 0.05U/microL Taq DNA poly (Boehringer Mannheim)Cycler:
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1283 Publication date: 08/94
PMID: 8085832 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenovirus Product size (PCR): 300 bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: Nested PCR 1
Temp (PCR cycle):37C 60min>94C 4min>(92C 90sec>55C 90sec>72C 120sec)*30
Buffer: 50mM KCl, 10mM Tris-HCl (pH 9.0), 0.01% (w/v) gelatin, 0.1% Triton X-100, 0.05U/microL UNG
Polymerase: 0.04U/microL Taq DNA poly (Promega)Cycler: programmable heat block (Coy Laboratory Products, Inc.; Ann Arbor, MI)
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1283 Publication date: 08/94
PMID: 8085832 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenovirus Product size (PCR): 300 bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: Nested PCR 1
Temp (PCR cycle):37C 60min>94C 4min>(92C 90sec>55C 90sec>72C 120sec)*30
Buffer: 50mM KCl, 10mM Tris-HCl (pH 9.0), 0.01% (w/v) gelatin, 0.1% Triton X-100, 0.05U/microL UNG
Polymerase: 0.04U/microL Taq DNA poly (Promega)Cycler: programmable heat block (Coy Laboratory Products, Inc.; Ann Arbor, MI)
Note:



Oligonucleotide information
Forward(H1) primer
Oligo ID:pd00603
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0713 Publication date: 07/96
PMID: 8818963 GI: 9626158 Taxonomy ID:28284
Virus Name: Human adenovirus type 40; Human adenovirus type 41 Product size (PCR):
bp
MgCl2: 2.0 mM dNTPs: 0.2 mM Type: PCR
Temp (PCR cycle):94C 7min>(94C 1min>40C 1min>72C 1min)*30
Buffer: 67mM Tris-HCl (pH 8.4), 16mM (NH4)2SO4, 0.17% BSA
Polymerase: 0.02U/microL AmpliTaq DNA poly (Perkin-Elmer-Cetus)Cycler:
Note:



Oligonucleotide information
Forward(PD00759) primer
Oligo ID:PD00759
Oligo type: Denegeracy: 1
Target: 245-269 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0524 Publication date: 07/93
PMID: 8370944 GI: 58498 Taxonomy ID:129875
Virus Name: Human adenovirus A; Human adenovirus B; Human adenovirus C; Human adenovirus D; Human adenovirus E; Human adenovirus F Product size (PCR): N/A bp
MgCl2: 2 mM dNTPs: 0.2 mM Type: Universal PCR
Temp (PCR cycle):95C 5min>(95C 1min>45C 1min>72C 1min)*30
Buffer: 10mM Tris HCl pH 8, 50mM KCl
Polymerase: 0.025U/microL Amplitaq DNA Taq poly (Perkin-Elmer Cetus)Cycler: DNA thermal cycler (Techne PHC2)
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:PC00011
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note: Article gives target as 18858-18883.

Experimental condition used for the oligonucleotide

Common Data ID: JP0031 Publication date: 12/90
PMID: 2279998 GI: 209811 Taxonomy ID:10515
Virus Name: Human adenovirus type 2, Ad2; Human adenovirus type 41, Ad41 Product size (PCR): 308 bp
MgCl2: 6.7 mM dNTPs: 0.2 mM Type: Universal PCR
Temp (PCR cycle):94C 4min>(94C 30sec>55C 30sec>70C 30sec)*30
Buffer: 16.6mM (NH4)2SO4, 67mM Tris-HCl, 10mM Beta-mercaptoethanol, 100ng/microL BSA
Polymerase: 0.04U/microL Taq poly (Perkin-Elmer Cetus)Cycler: Hybaid
Note: Article gives target as 18858-18883.



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:PC00011
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note: Article gives target as 18858-18883.

Experimental condition used for the oligonucleotide

Common Data ID: BM1104 Publication date: 09/98
PMID: 9726885 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenovirus Product size (PCR): 301 bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: Nested PCR 1
Temp (PCR cycle):94C 4min>(92C 90sec>55C 90sec>72C 120sec)*30
Buffer: 10mM Tris-HCl (pH 8.3), 50mM KCl
Polymerase: 0.04U/microL AmpliTaq DNA poly (Perkin-Elmer Cetus)Cycler: GeneAmp PCR System 2400 (Perkin-Elmer)
Note: Article gives target as 18858-18883.



Oligonucleotide information
Forward(PB00220) primer
Oligo ID:pb00220
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note: Outer primer specific to hexon gene of adenovirus.

Experimental condition used for the oligonucleotide

Common Data ID: BM0775 Publication date: 01/99
PMID: 10202219 GI: 9626158 Taxonomy ID:10515
Virus Name: Human adenovirus type 2 Product size (PCR):
bp
MgCl2: 2.5 mM dNTPs: 0.05 mM Type: Nested PCR
Temp (PCR cycle):94C 4min>(94C 1min>55C 1min>72C 1.5min)*35>72C 6.5min
Buffer: 10mM Tris-HCl (pH8.3), 50mM KCl
Polymerase: 0.03U/microL Taq poly (Gibco BRL)Cycler: Robocycler-40 (Stratagene)
Note: Outer primer specific to hexon gene of adenovirus.



Oligonucleotide information
Forward(HexAA1885) primer
Oligo ID:pr00067
Oligo type: Denegeracy: 1
Target: 21-45 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0906 Publication date: 2000
PMID: 11128065 GI: 3582749 Taxonomy ID:10519
Virus Name: Human adenovirus Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: Multiplex PCR
Temp (PCR cycle):94C 7min>(94C 30sec>65C 30sec>75C 30sec)*30>75C 5min
Buffer: 10mM Tris-HCl (pH 8.3), 50mM KCl
Polymerase: 0.025U/microL Taq poly (TaKaRa Shuzo; Japan)Cycler:
Note:



Oligonucleotide information
Forward(PB00585) primer
Oligo ID:pb00585
Oligo type: Denegeracy: 1
Target: 16777-16801 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note: Mismatches at positions 16780, 16783, and 16801.

Experimental condition used for the oligonucleotide

Common Data ID: BM0939 Publication date: 01/01
PMID: 11197551 GI: 1526575 Taxonomy ID:10512
Virus Name: canine adenovirus type 1 Product size (PCR): 301 bp
MgCl2: 2.6 mM dNTPs: 1.0 mM Type: PCR
Temp (PCR cycle):94C 5min>(94C 1min>53C 1min>72C 1min)*45>72C 10min
Buffer: 26mM Tris-HCl (pH 8.8)
Polymerase: 0.04U/microL Taq poly (Amersham Life Science Inc.; Arlington Heights, IL)Cycler:
Note: Mismatches at positions 16780, 16783, and 16801.



Oligonucleotide information
Forward(PB00220) primer
Oligo ID:pb00220
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note: Outer primer specific to hexon gene of adenovirus.

Experimental condition used for the oligonucleotide

Common Data ID: BM0775 Publication date: 01/99
PMID: 10202219 GI: 9626158 Taxonomy ID:10515
Virus Name: Human adenovirus type 2 Product size (PCR):
bp
MgCl2: 2.5 mM dNTPs: 0.05 mM Type: Nested PCR
Temp (PCR cycle):94C 4min>(94C 1min>55C 1min>72C 1.5min)*35>72C 6.5min
Buffer: 10mM Tris-HCl (pH8.3), 50mM KCl
Polymerase: 0.03U/microL Taq poly (Gibco BRL)Cycler: Robocycler-40 (Stratagene)
Note: Outer primer specific to hexon gene of adenovirus.



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0668 Publication date: 11/98
PMID: 9774586 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenovirus Product size (PCR): 308 bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: Universal PCR
Temp (PCR cycle):94C 6min>(94C 1min>55C 1min>72C 1.5min)*41
Buffer: 10mM Tris-HCl (pH 8.3), 50mM KCl
Polymerase: 0.05U/microL Taq poly (Perkin-Elmer)Cycler: termocycler 9600 (Perkin-Elmer)
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0683 Publication date: 11/94
PMID: 7852969 GI: 209811 Taxonomy ID:10533
Virus Name: Human adenovirus Product size (PCR):
bp
MgCl2: 3.0 mM dNTPs: 0.1 mM Type: Universal PCR
Temp (PCR cycle):92C 3min>(92C 30sec>56C 30sec>72C 30sec)*30
Buffer: 50mM KCl, 10mM Tris-HCl (pH 9.0), 0.1% Triton X-100
Polymerase: 0.02U/microL Taq DNA poly (Promega)Cycler: thermal cycler (Techne)
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1159 Publication date: 05/00
PMID: 10872077 GI: 323417 Taxonomy ID:12059
Virus Name: Enterovirus; Human adenovirus Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-Nested PCR 1
Temp (PCR cycle):94C 4min>(95C 30sec>55C 30sec>72C 60sec)*35>72C 7min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton-X-100
Polymerase: 0.025U/microL Taq poly (Promega)Cycler:
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1231 Publication date: 09/95
PMID: 7675483 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenoviruses Product size (PCR): 308 bp
MgCl2: 2.0 mM dNTPs: 0.1 mM Type: Universal PCR
Temp (PCR cycle):94C 4min>(92C 30sec>45C 45sec>70C 30sec)*35
Buffer: 100mM Tris-HCl (pH 8.3), 500mM KCl
Polymerase: 0.025U/microL AmpliTaq DNA polyCycler:
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1250 Publication date: 12/94
PMID: 7699615 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenovirus Product size (PCR): 301 bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: Universal PCR
Temp (PCR cycle):(94C 45sec>55C 60sec> 72C 120sec)*35
Buffer: 10mM Tris-HCl (pH 8.3), 50mM KCl, 100ng/microL gelatin
Polymerase: 0.05U/microL Taq DNA poly (Boehringer Mannheim)Cycler:
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1283 Publication date: 08/94
PMID: 8085832 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenovirus Product size (PCR): 300 bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: Nested PCR 1
Temp (PCR cycle):37C 60min>94C 4min>(92C 90sec>55C 90sec>72C 120sec)*30
Buffer: 50mM KCl, 10mM Tris-HCl (pH 9.0), 0.01% (w/v) gelatin, 0.1% Triton X-100, 0.05U/microL UNG
Polymerase: 0.04U/microL Taq DNA poly (Promega)Cycler: programmable heat block (Coy Laboratory Products, Inc.; Ann Arbor, MI)
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1283 Publication date: 08/94
PMID: 8085832 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenovirus Product size (PCR): 300 bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: Nested PCR 1
Temp (PCR cycle):37C 60min>94C 4min>(92C 90sec>55C 90sec>72C 120sec)*30
Buffer: 50mM KCl, 10mM Tris-HCl (pH 9.0), 0.01% (w/v) gelatin, 0.1% Triton X-100, 0.05U/microL UNG
Polymerase: 0.04U/microL Taq DNA poly (Promega)Cycler: programmable heat block (Coy Laboratory Products, Inc.; Ann Arbor, MI)
Note:



Oligonucleotide information
Forward(HL) primer
Oligo ID:PB00752
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1083 Publication date: 01/00
PMID: 10618230 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenovirus Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: Nested PCR 1
Temp (PCR cycle):94C 4min>(92C 60sec>55C 60sec>72C 75sec)*29>72C 4min
Buffer: 10mM Tris-HCl (pH 8.3), 50mM KCl
Polymerase: 0.04U/microL AmpliTaq DNA poly (Perkin-Elmer Cetus)Cycler: GeneAmp PCR System 2400 (Perkin-Elmer)
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pc00011
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note: Article gives target as 18858-18883.

Experimental condition used for the oligonucleotide

Common Data ID: JP0031 Publication date: 12/90
PMID: 2279998 GI: 209811 Taxonomy ID:10515
Virus Name: Human adenovirus type 2, Ad2; Human adenovirus type 41, Ad41 Product size (PCR): 308 bp
MgCl2: 6.7 mM dNTPs: 0.2 mM Type: Universal PCR
Temp (PCR cycle):94C 4min>(94C 30sec>55C 30sec>70C 30sec)*30
Buffer: 16.6mM (NH4)2SO4, 67mM Tris-HCl, 10mM Beta-mercaptoethanol, 100ng/microL BSA
Polymerase: 0.04U/microL Taq poly (Perkin-Elmer Cetus)Cycler: Hybaid
Note: Article gives target as 18858-18883.



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pc00011
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note: Article gives target as 18858-18883.

Experimental condition used for the oligonucleotide

Common Data ID: BM1104 Publication date: 09/98
PMID: 9726885 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenovirus Product size (PCR): 301 bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: Nested PCR 1
Temp (PCR cycle):94C 4min>(92C 90sec>55C 90sec>72C 120sec)*30
Buffer: 10mM Tris-HCl (pH 8.3), 50mM KCl
Polymerase: 0.04U/microL AmpliTaq DNA poly (Perkin-Elmer Cetus)Cycler: GeneAmp PCR System 2400 (Perkin-Elmer)
Note: Article gives target as 18858-18883.



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0668 Publication date: 11/98
PMID: 9774586 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenovirus Product size (PCR): 308 bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: Universal PCR
Temp (PCR cycle):94C 6min>(94C 1min>55C 1min>72C 1.5min)*41
Buffer: 10mM Tris-HCl (pH 8.3), 50mM KCl
Polymerase: 0.05U/microL Taq poly (Perkin-Elmer)Cycler: termocycler 9600 (Perkin-Elmer)
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0683 Publication date: 11/94
PMID: 7852969 GI: 209811 Taxonomy ID:10533
Virus Name: Human adenovirus Product size (PCR):
bp
MgCl2: 3.0 mM dNTPs: 0.1 mM Type: Universal PCR
Temp (PCR cycle):92C 3min>(92C 30sec>56C 30sec>72C 30sec)*30
Buffer: 50mM KCl, 10mM Tris-HCl (pH 9.0), 0.1% Triton X-100
Polymerase: 0.02U/microL Taq DNA poly (Promega)Cycler: thermal cycler (Techne)
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1159 Publication date: 05/00
PMID: 10872077 GI: 323417 Taxonomy ID:12059
Virus Name: Enterovirus; Human adenovirus Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-Nested PCR 1
Temp (PCR cycle):94C 4min>(95C 30sec>55C 30sec>72C 60sec)*35>72C 7min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton-X-100
Polymerase: 0.025U/microL Taq poly (Promega)Cycler:
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1231 Publication date: 09/95
PMID: 7675483 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenoviruses Product size (PCR): 308 bp
MgCl2: 2.0 mM dNTPs: 0.1 mM Type: Universal PCR
Temp (PCR cycle):94C 4min>(92C 30sec>45C 45sec>70C 30sec)*35
Buffer: 100mM Tris-HCl (pH 8.3), 500mM KCl
Polymerase: 0.025U/microL AmpliTaq DNA polyCycler:
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1250 Publication date: 12/94
PMID: 7699615 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenovirus Product size (PCR): 301 bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: Universal PCR
Temp (PCR cycle):(94C 45sec>55C 60sec> 72C 120sec)*35
Buffer: 10mM Tris-HCl (pH 8.3), 50mM KCl, 100ng/microL gelatin
Polymerase: 0.05U/microL Taq DNA poly (Boehringer Mannheim)Cycler:
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1283 Publication date: 08/94
PMID: 8085832 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenovirus Product size (PCR): 300 bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: Nested PCR 1
Temp (PCR cycle):37C 60min>94C 4min>(92C 90sec>55C 90sec>72C 120sec)*30
Buffer: 50mM KCl, 10mM Tris-HCl (pH 9.0), 0.01% (w/v) gelatin, 0.1% Triton X-100, 0.05U/microL UNG
Polymerase: 0.04U/microL Taq DNA poly (Promega)Cycler: programmable heat block (Coy Laboratory Products, Inc.; Ann Arbor, MI)
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1283 Publication date: 08/94
PMID: 8085832 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenovirus Product size (PCR): 300 bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: Nested PCR 1
Temp (PCR cycle):37C 60min>94C 4min>(92C 90sec>55C 90sec>72C 120sec)*30
Buffer: 50mM KCl, 10mM Tris-HCl (pH 9.0), 0.01% (w/v) gelatin, 0.1% Triton X-100, 0.05U/microL UNG
Polymerase: 0.04U/microL Taq DNA poly (Promega)Cycler: programmable heat block (Coy Laboratory Products, Inc.; Ann Arbor, MI)
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0668 Publication date: 11/98
PMID: 9774586 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenovirus Product size (PCR): 308 bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: Universal PCR
Temp (PCR cycle):94C 6min>(94C 1min>55C 1min>72C 1.5min)*41
Buffer: 10mM Tris-HCl (pH 8.3), 50mM KCl
Polymerase: 0.05U/microL Taq poly (Perkin-Elmer)Cycler: termocycler 9600 (Perkin-Elmer)
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0683 Publication date: 11/94
PMID: 7852969 GI: 209811 Taxonomy ID:10533
Virus Name: Human adenovirus Product size (PCR):
bp
MgCl2: 3.0 mM dNTPs: 0.1 mM Type: Universal PCR
Temp (PCR cycle):92C 3min>(92C 30sec>56C 30sec>72C 30sec)*30
Buffer: 50mM KCl, 10mM Tris-HCl (pH 9.0), 0.1% Triton X-100
Polymerase: 0.02U/microL Taq DNA poly (Promega)Cycler: thermal cycler (Techne)
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1159 Publication date: 05/00
PMID: 10872077 GI: 323417 Taxonomy ID:12059
Virus Name: Enterovirus; Human adenovirus Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-Nested PCR 1
Temp (PCR cycle):94C 4min>(95C 30sec>55C 30sec>72C 60sec)*35>72C 7min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton-X-100
Polymerase: 0.025U/microL Taq poly (Promega)Cycler:
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1231 Publication date: 09/95
PMID: 7675483 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenoviruses Product size (PCR): 308 bp
MgCl2: 2.0 mM dNTPs: 0.1 mM Type: Universal PCR
Temp (PCR cycle):94C 4min>(92C 30sec>45C 45sec>70C 30sec)*35
Buffer: 100mM Tris-HCl (pH 8.3), 500mM KCl
Polymerase: 0.025U/microL AmpliTaq DNA polyCycler:
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1250 Publication date: 12/94
PMID: 7699615 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenovirus Product size (PCR): 301 bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: Universal PCR
Temp (PCR cycle):(94C 45sec>55C 60sec> 72C 120sec)*35
Buffer: 10mM Tris-HCl (pH 8.3), 50mM KCl, 100ng/microL gelatin
Polymerase: 0.05U/microL Taq DNA poly (Boehringer Mannheim)Cycler:
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1283 Publication date: 08/94
PMID: 8085832 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenovirus Product size (PCR): 300 bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: Nested PCR 1
Temp (PCR cycle):37C 60min>94C 4min>(92C 90sec>55C 90sec>72C 120sec)*30
Buffer: 50mM KCl, 10mM Tris-HCl (pH 9.0), 0.01% (w/v) gelatin, 0.1% Triton X-100, 0.05U/microL UNG
Polymerase: 0.04U/microL Taq DNA poly (Promega)Cycler: programmable heat block (Coy Laboratory Products, Inc.; Ann Arbor, MI)
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1283 Publication date: 08/94
PMID: 8085832 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenovirus Product size (PCR): 300 bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: Nested PCR 1
Temp (PCR cycle):37C 60min>94C 4min>(92C 90sec>55C 90sec>72C 120sec)*30
Buffer: 50mM KCl, 10mM Tris-HCl (pH 9.0), 0.01% (w/v) gelatin, 0.1% Triton X-100, 0.05U/microL UNG
Polymerase: 0.04U/microL Taq DNA poly (Promega)Cycler: programmable heat block (Coy Laboratory Products, Inc.; Ann Arbor, MI)
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0668 Publication date: 11/98
PMID: 9774586 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenovirus Product size (PCR): 308 bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: Universal PCR
Temp (PCR cycle):94C 6min>(94C 1min>55C 1min>72C 1.5min)*41
Buffer: 10mM Tris-HCl (pH 8.3), 50mM KCl
Polymerase: 0.05U/microL Taq poly (Perkin-Elmer)Cycler: termocycler 9600 (Perkin-Elmer)
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0683 Publication date: 11/94
PMID: 7852969 GI: 209811 Taxonomy ID:10533
Virus Name: Human adenovirus Product size (PCR):
bp
MgCl2: 3.0 mM dNTPs: 0.1 mM Type: Universal PCR
Temp (PCR cycle):92C 3min>(92C 30sec>56C 30sec>72C 30sec)*30
Buffer: 50mM KCl, 10mM Tris-HCl (pH 9.0), 0.1% Triton X-100
Polymerase: 0.02U/microL Taq DNA poly (Promega)Cycler: thermal cycler (Techne)
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1159 Publication date: 05/00
PMID: 10872077 GI: 323417 Taxonomy ID:12059
Virus Name: Enterovirus; Human adenovirus Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-Nested PCR 1
Temp (PCR cycle):94C 4min>(95C 30sec>55C 30sec>72C 60sec)*35>72C 7min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton-X-100
Polymerase: 0.025U/microL Taq poly (Promega)Cycler:
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1231 Publication date: 09/95
PMID: 7675483 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenoviruses Product size (PCR): 308 bp
MgCl2: 2.0 mM dNTPs: 0.1 mM Type: Universal PCR
Temp (PCR cycle):94C 4min>(92C 30sec>45C 45sec>70C 30sec)*35
Buffer: 100mM Tris-HCl (pH 8.3), 500mM KCl
Polymerase: 0.025U/microL AmpliTaq DNA polyCycler:
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1250 Publication date: 12/94
PMID: 7699615 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenovirus Product size (PCR): 301 bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: Universal PCR
Temp (PCR cycle):(94C 45sec>55C 60sec> 72C 120sec)*35
Buffer: 10mM Tris-HCl (pH 8.3), 50mM KCl, 100ng/microL gelatin
Polymerase: 0.05U/microL Taq DNA poly (Boehringer Mannheim)Cycler:
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1283 Publication date: 08/94
PMID: 8085832 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenovirus Product size (PCR): 300 bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: Nested PCR 1
Temp (PCR cycle):37C 60min>94C 4min>(92C 90sec>55C 90sec>72C 120sec)*30
Buffer: 50mM KCl, 10mM Tris-HCl (pH 9.0), 0.01% (w/v) gelatin, 0.1% Triton X-100, 0.05U/microL UNG
Polymerase: 0.04U/microL Taq DNA poly (Promega)Cycler: programmable heat block (Coy Laboratory Products, Inc.; Ann Arbor, MI)
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1283 Publication date: 08/94
PMID: 8085832 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenovirus Product size (PCR): 300 bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: Nested PCR 1
Temp (PCR cycle):37C 60min>94C 4min>(92C 90sec>55C 90sec>72C 120sec)*30
Buffer: 50mM KCl, 10mM Tris-HCl (pH 9.0), 0.01% (w/v) gelatin, 0.1% Triton X-100, 0.05U/microL UNG
Polymerase: 0.04U/microL Taq DNA poly (Promega)Cycler: programmable heat block (Coy Laboratory Products, Inc.; Ann Arbor, MI)
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0668 Publication date: 11/98
PMID: 9774586 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenovirus Product size (PCR): 308 bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: Universal PCR
Temp (PCR cycle):94C 6min>(94C 1min>55C 1min>72C 1.5min)*41
Buffer: 10mM Tris-HCl (pH 8.3), 50mM KCl
Polymerase: 0.05U/microL Taq poly (Perkin-Elmer)Cycler: termocycler 9600 (Perkin-Elmer)
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0683 Publication date: 11/94
PMID: 7852969 GI: 209811 Taxonomy ID:10533
Virus Name: Human adenovirus Product size (PCR):
bp
MgCl2: 3.0 mM dNTPs: 0.1 mM Type: Universal PCR
Temp (PCR cycle):92C 3min>(92C 30sec>56C 30sec>72C 30sec)*30
Buffer: 50mM KCl, 10mM Tris-HCl (pH 9.0), 0.1% Triton X-100
Polymerase: 0.02U/microL Taq DNA poly (Promega)Cycler: thermal cycler (Techne)
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1159 Publication date: 05/00
PMID: 10872077 GI: 323417 Taxonomy ID:12059
Virus Name: Enterovirus; Human adenovirus Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-Nested PCR 1
Temp (PCR cycle):94C 4min>(95C 30sec>55C 30sec>72C 60sec)*35>72C 7min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton-X-100
Polymerase: 0.025U/microL Taq poly (Promega)Cycler:
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1231 Publication date: 09/95
PMID: 7675483 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenoviruses Product size (PCR): 308 bp
MgCl2: 2.0 mM dNTPs: 0.1 mM Type: Universal PCR
Temp (PCR cycle):94C 4min>(92C 30sec>45C 45sec>70C 30sec)*35
Buffer: 100mM Tris-HCl (pH 8.3), 500mM KCl
Polymerase: 0.025U/microL AmpliTaq DNA polyCycler:
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1250 Publication date: 12/94
PMID: 7699615 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenovirus Product size (PCR): 301 bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: Universal PCR
Temp (PCR cycle):(94C 45sec>55C 60sec> 72C 120sec)*35
Buffer: 10mM Tris-HCl (pH 8.3), 50mM KCl, 100ng/microL gelatin
Polymerase: 0.05U/microL Taq DNA poly (Boehringer Mannheim)Cycler:
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1283 Publication date: 08/94
PMID: 8085832 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenovirus Product size (PCR): 300 bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: Nested PCR 1
Temp (PCR cycle):37C 60min>94C 4min>(92C 90sec>55C 90sec>72C 120sec)*30
Buffer: 50mM KCl, 10mM Tris-HCl (pH 9.0), 0.01% (w/v) gelatin, 0.1% Triton X-100, 0.05U/microL UNG
Polymerase: 0.04U/microL Taq DNA poly (Promega)Cycler: programmable heat block (Coy Laboratory Products, Inc.; Ann Arbor, MI)
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1283 Publication date: 08/94
PMID: 8085832 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenovirus Product size (PCR): 300 bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: Nested PCR 1
Temp (PCR cycle):37C 60min>94C 4min>(92C 90sec>55C 90sec>72C 120sec)*30
Buffer: 50mM KCl, 10mM Tris-HCl (pH 9.0), 0.01% (w/v) gelatin, 0.1% Triton X-100, 0.05U/microL UNG
Polymerase: 0.04U/microL Taq DNA poly (Promega)Cycler: programmable heat block (Coy Laboratory Products, Inc.; Ann Arbor, MI)
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0668 Publication date: 11/98
PMID: 9774586 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenovirus Product size (PCR): 308 bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: Universal PCR
Temp (PCR cycle):94C 6min>(94C 1min>55C 1min>72C 1.5min)*41
Buffer: 10mM Tris-HCl (pH 8.3), 50mM KCl
Polymerase: 0.05U/microL Taq poly (Perkin-Elmer)Cycler: termocycler 9600 (Perkin-Elmer)
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0683 Publication date: 11/94
PMID: 7852969 GI: 209811 Taxonomy ID:10533
Virus Name: Human adenovirus Product size (PCR):
bp
MgCl2: 3.0 mM dNTPs: 0.1 mM Type: Universal PCR
Temp (PCR cycle):92C 3min>(92C 30sec>56C 30sec>72C 30sec)*30
Buffer: 50mM KCl, 10mM Tris-HCl (pH 9.0), 0.1% Triton X-100
Polymerase: 0.02U/microL Taq DNA poly (Promega)Cycler: thermal cycler (Techne)
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1159 Publication date: 05/00
PMID: 10872077 GI: 323417 Taxonomy ID:12059
Virus Name: Enterovirus; Human adenovirus Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-Nested PCR 1
Temp (PCR cycle):94C 4min>(95C 30sec>55C 30sec>72C 60sec)*35>72C 7min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton-X-100
Polymerase: 0.025U/microL Taq poly (Promega)Cycler:
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1231 Publication date: 09/95
PMID: 7675483 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenoviruses Product size (PCR): 308 bp
MgCl2: 2.0 mM dNTPs: 0.1 mM Type: Universal PCR
Temp (PCR cycle):94C 4min>(92C 30sec>45C 45sec>70C 30sec)*35
Buffer: 100mM Tris-HCl (pH 8.3), 500mM KCl
Polymerase: 0.025U/microL AmpliTaq DNA polyCycler:
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1250 Publication date: 12/94
PMID: 7699615 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenovirus Product size (PCR): 301 bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: Universal PCR
Temp (PCR cycle):(94C 45sec>55C 60sec> 72C 120sec)*35
Buffer: 10mM Tris-HCl (pH 8.3), 50mM KCl, 100ng/microL gelatin
Polymerase: 0.05U/microL Taq DNA poly (Boehringer Mannheim)Cycler:
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1283 Publication date: 08/94
PMID: 8085832 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenovirus Product size (PCR): 300 bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: Nested PCR 1
Temp (PCR cycle):37C 60min>94C 4min>(92C 90sec>55C 90sec>72C 120sec)*30
Buffer: 50mM KCl, 10mM Tris-HCl (pH 9.0), 0.01% (w/v) gelatin, 0.1% Triton X-100, 0.05U/microL UNG
Polymerase: 0.04U/microL Taq DNA poly (Promega)Cycler: programmable heat block (Coy Laboratory Products, Inc.; Ann Arbor, MI)
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:pd00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1283 Publication date: 08/94
PMID: 8085832 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenovirus Product size (PCR): 300 bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: Nested PCR 1
Temp (PCR cycle):37C 60min>94C 4min>(92C 90sec>55C 90sec>72C 120sec)*30
Buffer: 50mM KCl, 10mM Tris-HCl (pH 9.0), 0.01% (w/v) gelatin, 0.1% Triton X-100, 0.05U/microL UNG
Polymerase: 0.04U/microL Taq DNA poly (Promega)Cycler: programmable heat block (Coy Laboratory Products, Inc.; Ann Arbor, MI)
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:PD00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0668 Publication date: 11/98
PMID: 9774586 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenovirus Product size (PCR): 308 bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: Universal PCR
Temp (PCR cycle):94C 6min>(94C 1min>55C 1min>72C 1.5min)*41
Buffer: 10mM Tris-HCl (pH 8.3), 50mM KCl
Polymerase: 0.05U/microL Taq poly (Perkin-Elmer)Cycler: termocycler 9600 (Perkin-Elmer)
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:PD00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0683 Publication date: 11/94
PMID: 7852969 GI: 209811 Taxonomy ID:10533
Virus Name: Human adenovirus Product size (PCR):
bp
MgCl2: 3.0 mM dNTPs: 0.1 mM Type: Universal PCR
Temp (PCR cycle):92C 3min>(92C 30sec>56C 30sec>72C 30sec)*30
Buffer: 50mM KCl, 10mM Tris-HCl (pH 9.0), 0.1% Triton X-100
Polymerase: 0.02U/microL Taq DNA poly (Promega)Cycler: thermal cycler (Techne)
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:PD00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1159 Publication date: 05/00
PMID: 10872077 GI: 323417 Taxonomy ID:12059
Virus Name: Enterovirus; Human adenovirus Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-Nested PCR 1
Temp (PCR cycle):94C 4min>(95C 30sec>55C 30sec>72C 60sec)*35>72C 7min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton-X-100
Polymerase: 0.025U/microL Taq poly (Promega)Cycler:
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:PD00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1231 Publication date: 09/95
PMID: 7675483 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenoviruses Product size (PCR): 308 bp
MgCl2: 2.0 mM dNTPs: 0.1 mM Type: Universal PCR
Temp (PCR cycle):94C 4min>(92C 30sec>45C 45sec>70C 30sec)*35
Buffer: 100mM Tris-HCl (pH 8.3), 500mM KCl
Polymerase: 0.025U/microL AmpliTaq DNA polyCycler:
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:PD00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1250 Publication date: 12/94
PMID: 7699615 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenovirus Product size (PCR): 301 bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: Universal PCR
Temp (PCR cycle):(94C 45sec>55C 60sec> 72C 120sec)*35
Buffer: 10mM Tris-HCl (pH 8.3), 50mM KCl, 100ng/microL gelatin
Polymerase: 0.05U/microL Taq DNA poly (Boehringer Mannheim)Cycler:
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:PD00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1283 Publication date: 08/94
PMID: 8085832 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenovirus Product size (PCR): 300 bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: Nested PCR 1
Temp (PCR cycle):37C 60min>94C 4min>(92C 90sec>55C 90sec>72C 120sec)*30
Buffer: 50mM KCl, 10mM Tris-HCl (pH 9.0), 0.01% (w/v) gelatin, 0.1% Triton X-100, 0.05U/microL UNG
Polymerase: 0.04U/microL Taq DNA poly (Promega)Cycler: programmable heat block (Coy Laboratory Products, Inc.; Ann Arbor, MI)
Note:



Oligonucleotide information
Forward(hexAA1885) primer
Oligo ID:PD00598
Oligo type: Denegeracy: 1
Target: 18858-18882 Tm: 80.5 C at salt 1000.0mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1283 Publication date: 08/94
PMID: 8085832 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenovirus Product size (PCR): 300 bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: Nested PCR 1
Temp (PCR cycle):37C 60min>94C 4min>(92C 90sec>55C 90sec>72C 120sec)*30
Buffer: 50mM KCl, 10mM Tris-HCl (pH 9.0), 0.01% (w/v) gelatin, 0.1% Triton X-100, 0.05U/microL UNG
Polymerase: 0.04U/microL Taq DNA poly (Promega)Cycler: programmable heat block (Coy Laboratory Products, Inc.; Ann Arbor, MI)
Note:



Oligonucleotide information
Forward(HL) primer
Oligo ID:SG003201
Oligo type: Forward Primer Denegeracy: 1
Target: 18858-18883 Tm: 80.5C at salt 1000.0 mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note: Outside primer. Given range is one residue too long.

Experimental condition used for the oligonucleotide

Common Data ID: SG0032 Publication date: 03/04
PMID: 15006765 GI: 33694600 Taxonomy ID:10515
Virus Name: Human adenovirus type 2 Product size (PCR): 301 bp
MgCl2: 1.5 mM dNTPs: 0.025 mM Type: Nested PCR
Temp (PCR cycle):94C 240sec>(92C 60sec>55C 60sec>72C 75sec)*29>72C 420sec
Buffer: 1X PCR buffer [160mM (NH4)2SO4-670mM Tris-HCl(pH 8.8)
Polymerase: 2U Taq poly (Bioron GmbH)Cycler: Gene Amp PCR 2400 (Applied Biosystems)
Note: Outside primer. Given range is one residue too long.



Oligonucleotide information
Forward(2A) primer
Oligo ID:SG009201
Oligo type: Forward Primer Denegeracy: 1
Target: 18858-18882 Tm: 80.5C at salt 1000.0 mMLength: 25
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note: Outer Primer.

Experimental condition used for the oligonucleotide

Common Data ID: SG0092 Publication date: 2003
PMID: 12637082 GI: 33694600 Taxonomy ID:10515
Virus Name: Human adenovirus type 2 Product size (PCR): 301 bp
MgCl2: 3.5 mM dNTPs: 0.2 mM Type: Nested PCR
Temp (PCR cycle):94C 180sec>(94C 10sec>43C 10sec>72C 30sec)*35>72C 300sec
Buffer: 10mM Tris-HCl (pH 9.0)
Polymerase: 0.25U Taq poly (Promega)Cycler: Perkin Elmer GeneAmp 2400 or 9700 or a DNA Engine Tetrad PTC 225 (MJ Research)
Note: Outer Primer.

Total 87 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.