A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(Primer 2.1) primer
Oligo ID:MP00740
Oligo type: PCR Denegeracy: 1
Target: 9893-9912 Tm: 65.8 C at salt 1000.0mMLength: 20
Sequence: GATTTCAAGGGGACTTTTTT
(3 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0074 Publication date: 03/94
PMID: 8068309 GI: 7960753 Taxonomy ID:144353
Virus Name: bovine viral diarrhea virus, BVDV Product size (PCR): 205 bp
MgCl2: 1 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):(95C 1min>55C 1min> 75C 2min)*40
Buffer: PCR buffer (Promega)
Polymerase: 0.25U/microL Taq poly (Promega)Cycler: N/A
Note:



Oligonucleotide information
Forward(MP00811) primer
Oligo ID:MP00810
Oligo type: PCR Denegeracy: 1
Target: 9893-9912 Tm: 65.8 C at salt 1000.0mMLength: 20
Sequence: GATTTCAAGGGGACTTTTTT
(3 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0081 Publication date: 01/94
PMID: 8011781 GI: 7960753 Taxonomy ID:11100
Virus Name: bovine viral diarrhea virus (isolate NADL), BVDV Product size (PCR): 205 bp
MgCl2: 1.4 mM dNTPs: 1.18 mM Type: RT-PCR
Temp (PCR cycle):(95C 1min>55C 1min>72C 2min)*40
Buffer: 40mM Tris-HCl, 60mM KCl, 1% gelatin, 5microL RT reaction
Polymerase: 0.5U/microL Taq poly (Promega, Madison, WI.)Cycler: N/A
Note:



Oligonucleotide information
Forward(Primer 2.1) primer
Oligo ID:SW00470
Oligo type: PCR Denegeracy: 1
Target: 9893-9912 Tm: 65.8 C at salt 1000.0mMLength: 20
Sequence: GATTTCAAGGGGACTTTTTT
(3 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SW0047 Publication date: 03/91
PMID: 1709950 GI: 9626649 Taxonomy ID:11100
Virus Name: bovine viral diarrhea virus (isolate NADL) Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.8 mM Type: RT-PCR
Temp (PCR cycle):95C 5min>(95C 1min>55C 1min>72C 2min)*40
Buffer: 40mM Tris-HCl, 50mM KCl, 0.1% gelatin
Polymerase: 0.03U/microL Taq poly (Perkin-Elmer Cetus)Cycler: automated thermal cycler (Perkin-Elmer Cetus)
Note:



Oligonucleotide information
Forward(L1) primer
Oligo ID:pb00387
Oligo type: Denegeracy: 1
Target: 9893-9912 Tm: 65.8 C at salt 1000.0mMLength: 20
Sequence: GATTTCAAGGGGACTTTTTT
(3 other experimental conditions)
Note: Used with primer L2 to amplify a 206 bp product.

Experimental condition used for the oligonucleotide

Common Data ID: BM0058 Publication date: 1994
PMID: 8031236 GI: 7960753 Taxonomy ID:11100
Virus Name: bovine viral diarrhea virus isolates NADL and SD-1, NADL and SD-1; Hog cholera virus strains Alfort and Brescia, Alfort and Brescia; border disease virus strains Moredun cp and Moredun ncp, Moredun CP and Moredun NCP Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):(95C 1min>56C 1min>72C 1min)*35
Buffer: 10mM Tris-HCl (pH 8.3), 50mM KCl, 0.1mg/mL gelatine
Polymerase: 0.04U/microL Taq DNA poly (Boehringer Mannheim)Cycler:
Note: Used with primer L2 to amplify a 206 bp product.

Total 4 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.