A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(P1) primer
Oligo ID:BH00562
Oligo type: PCR Denegeracy: 1
Target: 3578-3558 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in BLAST differs than that given in article (3592-3572).

Experimental condition used for the oligonucleotide

Common Data ID: BH0056 Publication date: 04/93
PMID: 8391540 GI: 61076 Taxonomy ID:12118
Virus Name: Foot-and-mouth disease virus O, FMDV Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.04 mM Type: RT-PCR
Temp (PCR cycle):100C 2min>(94C 30sec>60C 30sec>72C 120sec)*30
Buffer: 66mM Tris-HCl (pH 8.8), 16.6mM (NH4)2SO4, 10mM beta-mercaptoethanol, 8.4ng/microL BSA
Polymerase: 0.04U/microL polyCycler: Intelligent Heating Block (Hybaid)
Note: Target found in BLAST differs than that given in article (3592-3572).



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: PCR Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0308 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: PCR Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0309 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: PCR Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0310 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: PCR Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0311 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: PCR Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0312 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: PCR Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0313 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: PCR Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0314 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 5min>(95C 15sec>60C 60sec)*25>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: PCR Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0315 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 5min>(95C 15sec>60C 60sec)*25>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:PD00195
Oligo type: Denegeracy: 1
Target: 753-733 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: JX0029 Publication date: 02/95
PMID: 7714205 GI: 61060 Taxonomy ID:12113
Virus Name: Foot-and-mouth disease virus (strain A5); foot-and-mouth disease virus C1; Foot-and-mouth disease virus (strain O1) Product size (PCR):
bp
MgCl2: 2.5 mM dNTPs: 0.25 mM Type: RT-PCR
Temp (PCR cycle):(95C 15sec>55C 15sec>72C 45sec)*30
Buffer: 25mM Tris-HCl (pH 8.4), 75mM KCl
Polymerase: 0.025U/microL SuperTaq poly (Stehelin, Basel, Switzerland)Cycler: Bio-med Thermocycler 60 (Gesellschaft fur Biotechnologie und Medizinterchnik, Theres, Germany)
Note:



Oligonucleotide information
Reverse(P1) primer
Oligo ID:MP03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0308 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:MP03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0309 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:MP03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0310 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:MP03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0311 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:MP03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0312 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:MP03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0313 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:MP03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0314 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 5min>(95C 15sec>60C 60sec)*25>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:MP03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0315 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 5min>(95C 15sec>60C 60sec)*25>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0308 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0309 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0310 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0311 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0312 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0313 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0314 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 5min>(95C 15sec>60C 60sec)*25>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0315 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 5min>(95C 15sec>60C 60sec)*25>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0308 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0309 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0310 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0311 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0312 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0313 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0314 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 5min>(95C 15sec>60C 60sec)*25>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0315 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 5min>(95C 15sec>60C 60sec)*25>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0308 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0309 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0310 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0311 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0312 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0313 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0314 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 5min>(95C 15sec>60C 60sec)*25>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0315 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 5min>(95C 15sec>60C 60sec)*25>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0308 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0309 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0310 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0311 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0312 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0313 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0314 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 5min>(95C 15sec>60C 60sec)*25>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0315 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 5min>(95C 15sec>60C 60sec)*25>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0308 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0309 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0310 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0311 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0312 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0313 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0314 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 5min>(95C 15sec>60C 60sec)*25>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0315 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 5min>(95C 15sec>60C 60sec)*25>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0308 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0309 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0310 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0311 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0312 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0313 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0314 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 5min>(95C 15sec>60C 60sec)*25>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0315 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 5min>(95C 15sec>60C 60sec)*25>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:PD00212
Oligo type: Denegeracy: 1
Target: 3578-3558 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST

Experimental condition used for the oligonucleotide

Common Data ID: MP0392 Publication date: 08/97
PMID: 9274816 GI: 3367676 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1 Product size (PCR): 246 bp
MgCl2: 1.5 mM dNTPs: 0.5 mM Type: RT-Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note: Target found in article (3649-3670) is different from target found in BLAST



Oligonucleotide information
Reverse(P1) primer
Oligo ID:PD00212
Oligo type: Denegeracy: 1
Target: 3578-3558 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST

Experimental condition used for the oligonucleotide

Common Data ID: MP0393 Publication date: 08/97
PMID: 9274816 GI: 6572136 Taxonomy ID:35292
Virus Name: Foot-and-mouth disease virus SAT 2 Product size (PCR): 75 bp
MgCl2: 1.5 mM dNTPs: 0.5 mM Type: RT-Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note: Target found in article (3649-3670) is different from target found in BLAST



Oligonucleotide information
Reverse(P1) primer
Oligo ID:PD00212
Oligo type: Denegeracy: 1
Target: 3578-3558 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST

Experimental condition used for the oligonucleotide

Common Data ID: MP0394 Publication date: 08/97
PMID: 9274816 GI: 576561 Taxonomy ID:12123
Virus Name: Foot-and-mouth disease virus SAT 3 Product size (PCR): 301 bp
MgCl2: 1.5 mM dNTPs: 0.5 mM Type: RT-Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note: Target found in article (3649-3670) is different from target found in BLAST



Oligonucleotide information
Reverse(P1) primer
Oligo ID:PD00212
Oligo type: Denegeracy: 1
Target: 3578-3558 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST

Experimental condition used for the oligonucleotide

Common Data ID: MP0392 Publication date: 08/97
PMID: 9274816 GI: 3367676 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1 Product size (PCR): 246 bp
MgCl2: 1.5 mM dNTPs: 0.5 mM Type: RT-Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note: Target found in article (3649-3670) is different from target found in BLAST



Oligonucleotide information
Reverse(P1) primer
Oligo ID:PD00212
Oligo type: Denegeracy: 1
Target: 3578-3558 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST

Experimental condition used for the oligonucleotide

Common Data ID: MP0393 Publication date: 08/97
PMID: 9274816 GI: 6572136 Taxonomy ID:35292
Virus Name: Foot-and-mouth disease virus SAT 2 Product size (PCR): 75 bp
MgCl2: 1.5 mM dNTPs: 0.5 mM Type: RT-Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note: Target found in article (3649-3670) is different from target found in BLAST



Oligonucleotide information
Reverse(P1) primer
Oligo ID:PD00212
Oligo type: Denegeracy: 1
Target: 3578-3558 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST

Experimental condition used for the oligonucleotide

Common Data ID: MP0394 Publication date: 08/97
PMID: 9274816 GI: 576561 Taxonomy ID:12123
Virus Name: Foot-and-mouth disease virus SAT 3 Product size (PCR): 301 bp
MgCl2: 1.5 mM dNTPs: 0.5 mM Type: RT-Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note: Target found in article (3649-3670) is different from target found in BLAST



Oligonucleotide information
Reverse(P1) primer
Oligo ID:PD00212
Oligo type: Denegeracy: 1
Target: 3578-3558 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST

Experimental condition used for the oligonucleotide

Common Data ID: MP0392 Publication date: 08/97
PMID: 9274816 GI: 3367676 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1 Product size (PCR): 246 bp
MgCl2: 1.5 mM dNTPs: 0.5 mM Type: RT-Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note: Target found in article (3649-3670) is different from target found in BLAST



Oligonucleotide information
Reverse(P1) primer
Oligo ID:PD00212
Oligo type: Denegeracy: 1
Target: 3578-3558 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST

Experimental condition used for the oligonucleotide

Common Data ID: MP0393 Publication date: 08/97
PMID: 9274816 GI: 6572136 Taxonomy ID:35292
Virus Name: Foot-and-mouth disease virus SAT 2 Product size (PCR): 75 bp
MgCl2: 1.5 mM dNTPs: 0.5 mM Type: RT-Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note: Target found in article (3649-3670) is different from target found in BLAST



Oligonucleotide information
Reverse(P1) primer
Oligo ID:PD00212
Oligo type: Denegeracy: 1
Target: 3578-3558 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST

Experimental condition used for the oligonucleotide

Common Data ID: MP0394 Publication date: 08/97
PMID: 9274816 GI: 576561 Taxonomy ID:12123
Virus Name: Foot-and-mouth disease virus SAT 3 Product size (PCR): 301 bp
MgCl2: 1.5 mM dNTPs: 0.5 mM Type: RT-Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note: Target found in article (3649-3670) is different from target found in BLAST



Oligonucleotide information
Reverse(P1) primer
Oligo ID:pj00344
Oligo type: Denegeracy: 1
Target: 3923-3903 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Mismatch at position 3914.

Experimental condition used for the oligonucleotide

Common Data ID: BM0536 Publication date: 03/98
PMID: 9629589 GI: 12018088 Taxonomy ID:12111
Virus Name: Foot-and-mouth disease virus A; Foot-and-mouth disease virus C; Foot-and-mouth disease virus O; Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: N/A mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):96C 60sec>(96C 12sec>49C 20sec>70C 40sec)*30
Buffer: 1x buffer (DynaZyme)
Polymerase: 0.02U/microL Taq poly (DynaZyme)Cycler:
Note: Mismatch at position 3914.



Oligonucleotide information
Reverse(P2) primer
Oligo ID:pj00363
Oligo type: Denegeracy: 1
Target: 3378-3358 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0546 Publication date: 1993
PMID: 8385843 GI: 61076 Taxonomy ID:12115
Virus Name: Foot-and-mouth disease virus (strain A24 Cruzeiro); Foot-and-mouth disease virus Asia 1; foot-and-mouth disease virus C1; Foot-and-mouth disease virus O; Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 5min>(94C 1min>50C 1min>70C 2min)*30>70C 7min
Buffer: 66mM Tris-HCl (pH 8.3), 17mM (NH4)2SO4, 850microg/mL BSA, 10mM 2-mercaptoethanol
Polymerase: 1.25U Taq poly (AmpliTaq, Perkin-Elmer Cetus)Cycler: thermal cycler (Perkin-Elmer Cetus)
Note:



Oligonucleotide information
Reverse(P4) primer
Oligo ID:PB01461
Oligo type: Denegeracy: 1
Target: 3946-3926 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0734 Publication date: 07/02
PMID: 12088821 GI: 18074008 Taxonomy ID:110195
Virus Name: Foot-and-mouth disease virus Asia 1, FMDV Product size (PCR):
bp
MgCl2: N/A mM dNTPs: N/A mM Type: RT-PCR
Temp (PCR cycle):(93C 30sec>55C 120sec>72C 300sec)*40>72C 10min
Buffer: N/A
Polymerase: N/ACycler: N/A
Note:



Oligonucleotide information
Reverse(P4) primer
Oligo ID:PB01461
Oligo type: Denegeracy: 1
Target: 3946-3926 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0735 Publication date: 07/02
PMID: 12088821 GI: 18074008 Taxonomy ID:110195
Virus Name: Foot-and-mouth disease virus Asia 1, FMDV Product size (PCR):
bp
MgCl2: N/A mM dNTPs: N/A mM Type: RT-PCR
Temp (PCR cycle):(93C 30sec>55C 120sec>72C 300sec)*40>72C 10min
Buffer: N/A
Polymerase: N/ACycler: N/A
Note:



Oligonucleotide information
Reverse(P4) primer
Oligo ID:PB01461
Oligo type: Denegeracy: 1
Target: 3946-3926 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0734 Publication date: 07/02
PMID: 12088821 GI: 18074008 Taxonomy ID:110195
Virus Name: Foot-and-mouth disease virus Asia 1, FMDV Product size (PCR):
bp
MgCl2: N/A mM dNTPs: N/A mM Type: RT-PCR
Temp (PCR cycle):(93C 30sec>55C 120sec>72C 300sec)*40>72C 10min
Buffer: N/A
Polymerase: N/ACycler: N/A
Note:



Oligonucleotide information
Reverse(P4) primer
Oligo ID:PB01461
Oligo type: Denegeracy: 1
Target: 3946-3926 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0735 Publication date: 07/02
PMID: 12088821 GI: 18074008 Taxonomy ID:110195
Virus Name: Foot-and-mouth disease virus Asia 1, FMDV Product size (PCR):
bp
MgCl2: N/A mM dNTPs: N/A mM Type: RT-PCR
Temp (PCR cycle):(93C 30sec>55C 120sec>72C 300sec)*40>72C 10min
Buffer: N/A
Polymerase: N/ACycler: N/A
Note:



Oligonucleotide information
Reverse(P4) primer
Oligo ID:PB01461
Oligo type: Denegeracy: 1
Target: 3946-3926 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0734 Publication date: 07/02
PMID: 12088821 GI: 18074008 Taxonomy ID:110195
Virus Name: Foot-and-mouth disease virus Asia 1, FMDV Product size (PCR):
bp
MgCl2: N/A mM dNTPs: N/A mM Type: RT-PCR
Temp (PCR cycle):(93C 30sec>55C 120sec>72C 300sec)*40>72C 10min
Buffer: N/A
Polymerase: N/ACycler: N/A
Note:



Oligonucleotide information
Reverse(P4) primer
Oligo ID:PB01461
Oligo type: Denegeracy: 1
Target: 3946-3926 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0735 Publication date: 07/02
PMID: 12088821 GI: 18074008 Taxonomy ID:110195
Virus Name: Foot-and-mouth disease virus Asia 1, FMDV Product size (PCR):
bp
MgCl2: N/A mM dNTPs: N/A mM Type: RT-PCR
Temp (PCR cycle):(93C 30sec>55C 120sec>72C 300sec)*40>72C 10min
Buffer: N/A
Polymerase: N/ACycler: N/A
Note:



Oligonucleotide information
Reverse(P4) primer
Oligo ID:PB01461
Oligo type: Denegeracy: 1
Target: 3946-3926 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0734 Publication date: 07/02
PMID: 12088821 GI: 18074008 Taxonomy ID:110195
Virus Name: Foot-and-mouth disease virus Asia 1, FMDV Product size (PCR):
bp
MgCl2: N/A mM dNTPs: N/A mM Type: RT-PCR
Temp (PCR cycle):(93C 30sec>55C 120sec>72C 300sec)*40>72C 10min
Buffer: N/A
Polymerase: N/ACycler: N/A
Note:



Oligonucleotide information
Reverse(P4) primer
Oligo ID:PB01461
Oligo type: Denegeracy: 1
Target: 3946-3926 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0735 Publication date: 07/02
PMID: 12088821 GI: 18074008 Taxonomy ID:110195
Virus Name: Foot-and-mouth disease virus Asia 1, FMDV Product size (PCR):
bp
MgCl2: N/A mM dNTPs: N/A mM Type: RT-PCR
Temp (PCR cycle):(93C 30sec>55C 120sec>72C 300sec)*40>72C 10min
Buffer: N/A
Polymerase: N/ACycler: N/A
Note:

Total 85 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.