A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(SH00101) primer
Oligo ID:SH00100
Oligo type: PCR Denegeracy: 1
Target: 1123-1104 Tm: 70 C at salt 1000.0mMLength: 20
Sequence: CATTGTGTCACAGAACACTC
(1 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SH0010 Publication date: 05/93
PMID: 8501223 GI: 210828 Taxonomy ID:82821
Virus Name: bovine respiratory syncytial virus strain 375 Product size (PCR):
bp
MgCl2: N/A mM dNTPs: N/A mM Type: RT-PCR
Temp (PCR cycle):95C 30sec>(95C 15sec>60C 15sec)*35>60C 1.75min
Buffer: N/A
Polymerase: N/ACycler: GeneAmp PCR System 9600 (Perkin-Elmer Cetus)
Note:



Oligonucleotide information
Reverse(VW00242) primer
Oligo ID:VW00241
Oligo type: PCR Denegeracy: 1
Target: 1123-1104 Tm: 70 C at salt 1000.0mMLength: 20
Sequence: CATTGTGTCACAGAACACTC
(1 other experimental conditions)
Note: BRSV specific primer. Derived from [GI:210828].

Experimental condition used for the oligonucleotide

Common Data ID: VW0024 Publication date: 07/93
PMID: 8373845 GI: 210828 Taxonomy ID:150548
Virus Name: Bovine respiratory syncytial virus A51908, BRSV, Human respiratory syncytial virus (subgroup A / strain Long), HRSV Product size (PCR):
bp
MgCl2: N/A mM dNTPs: N/A mM Type: RT-PCR
Temp (PCR cycle):95C 30sec>(95C 15sec>60C 15sec)*35>60C 105sec
Buffer: N/A
Polymerase: N/ACycler: GeneAmp PCR System 9600 (Perkin Elmer)
Note: BRSV specific primer. Derived from [GI:210828].

Total 2 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.