A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(HR) primer
Oligo ID:PB00753
Oligo type: Denegeracy: 1
Target: 19158-19136 Tm: 82.1 C at salt 1000.0mMLength: 24
Sequence: CAGCACGCCGCGGATGTCCAAAGT
(1 other experimental conditions)
Note: Sequence in article gives in extra "C" between positions 19141 and 19142

Experimental condition used for the oligonucleotide

Common Data ID: BM1083 Publication date: 01/00
PMID: 10618230 GI: 209811 Taxonomy ID:10509
Virus Name: Human adenovirus Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: Nested PCR 1
Temp (PCR cycle):94C 4min>(92C 60sec>55C 60sec>72C 75sec)*29>72C 4min
Buffer: 10mM Tris-HCl (pH 8.3), 50mM KCl
Polymerase: 0.04U/microL AmpliTaq DNA poly (Perkin-Elmer Cetus)Cycler: GeneAmp PCR System 2400 (Perkin-Elmer)
Note: Sequence in article gives in extra "C" between positions 19141 and 19142



Oligonucleotide information
Reverse(HR) primer
Oligo ID:SG003202
Oligo type: Reverse Primer Denegeracy: 1
Target: 19158-19136 Tm: 82.1C at salt 1000.0 mMLength: 24
Sequence: CAGCACGCCGCGGATGTCCAAAGT
(1 other experimental conditions)
Note: Outside primer. Given range is one residue too short

Experimental condition used for the oligonucleotide

Common Data ID: SG0032 Publication date: 03/04
PMID: 15006765 GI: 33694600 Taxonomy ID:10515
Virus Name: Human adenovirus type 2 Product size (PCR): 301 bp
MgCl2: 1.5 mM dNTPs: 0.025 mM Type: Nested PCR
Temp (PCR cycle):94C 240sec>(92C 60sec>55C 60sec>72C 75sec)*29>72C 420sec
Buffer: 1X PCR buffer [160mM (NH4)2SO4-670mM Tris-HCl(pH 8.8)
Polymerase: 2U Taq poly (Bioron GmbH)Cycler: Gene Amp PCR 2400 (Applied Biosystems)
Note: Outside primer. Given range is one residue too short

Total 2 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.