A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(Ext F) primer
Oligo ID:MO00010
Oligo type: PCR Denegeracy: 1
Target: 1007-1028 Tm: 78.5 C at salt 1000.0mMLength: 22
Sequence: CACGGACCTGGTGGACAAGAAG
(4 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MO0001 Publication date: 08/98
PMID: 9810617 GI: 330756 Taxonomy ID:10320
Virus Name: Bovine herpesvirus 1 BHV1 Product size (PCR): 468 bp
MgCl2: 2.5 mM dNTPs: 200 mM Type: NESTED PCR 1
Temp (PCR cycle):(95C 60sec>56C 60sec>72C 60sec)*35>72C 6min
Buffer: 10mM Tris-HCl pH 8.3; 50mM KCl; 5% glycerol
Polymerase: 1.0U/microL Taq polyCycler:
Note:



Oligonucleotide information
Forward(AM00061) primer
Oligo ID:AM00060
Oligo type: PCR Denegeracy: 1
Target: 1007-1028 Tm: 78.5 C at salt 1000.0mMLength: 22
Sequence: CACGGACCTGGTGGACAAGAAG
(4 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: AM0006 Publication date: 02/93
PMID: 8388400 GI: 330756 Taxonomy ID:10320
Virus Name: Bovine herpesvirus 1, BHV-1 Product size (PCR):
bp
MgCl2: N/A mM dNTPs: 2 mM Type: PCR
Temp (PCR cycle):(95C 1min>56C 1min>73C 1min)*35
Buffer: 1 X Reaction buffer(Perkin-Elmer)
Polymerase: 4U/microL Taq Poly(Perkin-Elmer)Cycler:
Note:



Oligonucleotide information
Forward(P1) primer
Oligo ID:SW00190
Oligo type: PCR Denegeracy: 1
Target: 1007-1028 Tm: 78.5 C at salt 1000.0mMLength: 22
Sequence: CACGGACCTGGTGGACAAGAAG
(4 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SW0019 Publication date: 12/96
PMID: 8997877 GI: 330756 Taxonomy ID:10320
Virus Name: Bovine herpesvirus 1, BHV-1 Product size (PCR): 468 bp
MgCl2: N/A mM dNTPs: 0.8 mM Type: PCR
Temp (PCR cycle):96C 6min>(95C 1min>58C 1min>72C 1min)*35
Buffer: 5microL Taq polymerase buffer (Perkin-Elmer), 4% DMSO
Polymerase: 0.02U/microL AmpliTaq DNA poly (Perkin-Elmer)Cycler:
Note:



Oligonucleotide information
Forward(P1) primer
Oligo ID:KS00210
Oligo type: PCR Denegeracy: 1
Target: 56017-56038 Tm: 78.5 C at salt 1000.0mMLength: 22
Sequence: CACGGACCTGGTGGACAAGAAG
(4 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: KS0021 Publication date: 12/97
PMID: 9607088 GI: 9629818 Taxonomy ID:10320
Virus Name: Bovine herpesvirus 1 Product size (PCR):
bp
MgCl2: 1.0 mM dNTPs: 0.2 mM Type: PCR
Temp (PCR cycle):(95C 1min>56C 1min>72C 1min)*35>72C 5min
Buffer: 10% glycerol, Taq polymerase buffer
Polymerase: 0.06U/microL Taq DNA polyCycler:
Note:



Oligonucleotide information
Forward(Ext F) primer
Oligo ID:pb00358
Oligo type: Denegeracy: 1
Target: 1007-1028 Tm: 78.5 C at salt 1000.0mMLength: 22
Sequence: CACGGACCTGGTGGACAAGAAG
(4 other experimental conditions)
Note: Specific to the gp I glycoprotein region.
Target given in article is 624-645.

Experimental condition used for the oligonucleotide

Common Data ID: BM0040 Publication date: 03/99
PMID: 10359157 GI: 330756 Taxonomy ID:10320
Virus Name: Bovine herpesvirus 1, BHV-1 Product size (PCR):
bp
MgCl2: 2.5 mM dNTPs: 200 mM Type: Nested PCR 1
Temp (PCR cycle):(95C 60sec>56C 60sec>72C 60sec)*35>72C 5min
Buffer: 10mM Tris-HCl (pH 8.3) 50mM KCl, 5% (w/v) glycerol
Polymerase: 0.05U/microL Taq DNA polyCycler:
Note: Specific to the gp I glycoprotein region.
Target given in article is 624-645.

Total 5 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.