A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(COR-1) primer
Oligo ID:UM00210
Oligo type: PCR Denegeracy: 1
Target: 15318-15343 Tm: 77.3 C at salt 1000.0mMLength: 26
Sequence: CACCGTTTCTACAGGTTAGCTAACGA
(6 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: UM0021 Publication date: 04/03
PMID: N/A GI: 30523247 Taxonomy ID:227984
Virus Name: SARS coronavirus Product size (PCR): 310 bp
MgCl2: N/A mM dNTPs: N/A mM Type: RT-PCR
Temp (PCR cycle):N/A
Buffer: N/A
Polymerase: N/ACycler: N/A
Note: Target range from sequence.



Oligonucleotide information
Forward(COR-1) primer
Oligo ID:SG004103
Oligo type: Forward Primer Denegeracy: 1
Target: 15318-15343 Tm: 77.3C at salt 1000.0 mMLength: 26
Sequence: CACCGTTTCTACAGGTTAGCTAACGA
(6 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0041 Publication date: 2003
PMID: 14652014 GI: 30248028 Taxonomy ID:227984
Virus Name: SARS coronavirus Tor2 Product size (PCR): 285 bp
MgCl2: 5 mM dNTPs: 0.2 mM Type: PCR
Temp (PCR cycle):95C 180sec>(95C 10sec>60C 10sec[-1C/Cyc]>72C 20sec)*10>(95C 10sec>56C 10sec>72C 20sec)*40
Buffer: 1x PCR buffer
Polymerase: 0.04U/microL Taq DNA polymerase (Invitrogen)Cycler: MasterCycler (Eppendorf)
Note:



Oligonucleotide information
Forward(COR-1) primer
Oligo ID:SG006501
Oligo type: Forward Primer Denegeracy: 1
Target: 15318-15343 Tm: 77.3C at salt 1000.0 mMLength: 26
Sequence: CACCGTTTCTACAGGTTAGCTAACGA
(6 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0065 Publication date: 11/03
PMID: 14718079 GI: 33578015 Taxonomy ID:242743
Virus Name: SARS coronavirus FRA Product size (PCR): 311 bp
MgCl2: 25 mM dNTPs: 2.5 mM Type: Q-RT-PCR
Temp (PCR cycle):94C 180sec>(94C 30sec>60C 30sec>72C 60sec)*45>72C 7min
Buffer: 1.1x buffer (Amersham Pharmacia Biotech)
Polymerase: 5U/mL Taq polyCycler: GeneAmp PCR System 9700 (Applied Biosystem)
Note:



Oligonucleotide information
Forward(COR-1) primer
Oligo ID:SG007601
Oligo type: Forward Primer Denegeracy: 1
Target: 15319-15344 Tm: 77.3C at salt 1000.0 mMLength: 26
Sequence: CACCGTTTCTACAGGTTAGCTAACGA
(6 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0076 Publication date: 02/04
PMID: 15030711 GI: 37960831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 310 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: Cycler:
Note:



Oligonucleotide information
Forward(COR-1) primer
Oligo ID:SG007601
Oligo type: Forward Primer Denegeracy: 1
Target: 15319-15344 Tm: 77.3C at salt 1000.0 mMLength: 26
Sequence: CACCGTTTCTACAGGTTAGCTAACGA
(6 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0078 Publication date: 09/03
PMID: 14519240 GI: 37960831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 310 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):50C 1800sec>94C 180sec>(94C 30sec>52C 30sec>72C 45sec)*40>72C 420sec
Buffer:
Polymerase: Cycler:
Note:



Oligonucleotide information
Forward(COR-1) primer
Oligo ID:sg007601
Oligo type: Forward Primer Denegeracy: 1
Target: 15319-15344 Tm: 77.3C at salt 1000.0 mMLength: 26
Sequence: CACCGTTTCTACAGGTTAGCTAACGA
(6 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0076 Publication date: 02/04
PMID: 15030711 GI: 37960831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 310 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: Cycler:
Note:



Oligonucleotide information
Forward(COR-1) primer
Oligo ID:sg007601
Oligo type: Forward Primer Denegeracy: 1
Target: 15319-15344 Tm: 77.3C at salt 1000.0 mMLength: 26
Sequence: CACCGTTTCTACAGGTTAGCTAACGA
(6 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0078 Publication date: 09/03
PMID: 14519240 GI: 37960831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 310 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):50C 1800sec>94C 180sec>(94C 30sec>52C 30sec>72C 45sec)*40>72C 420sec
Buffer:
Polymerase: Cycler:
Note:



Oligonucleotide information
Forward(COR-1) primer
Oligo ID:TA005001
Oligo type: Forward Primer Denegeracy: 1
Target: 15318-15343 Tm: 77.3C at salt 1000.0 mMLength: 26
Sequence: CACCGTTTCTACAGGTTAGCTAACGA
(6 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: TA0050 Publication date: 05/04
PMID: 15200815 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): bp
MgCl2: mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 45sec>60C 45sec>72C 45sec)*45>72C 7min
Buffer: 1.2mM Magnesium sulphate
Polymerase: Platinum Taq (Invitrogen)Cycler:
Note:



Oligonucleotide information
Forward(COR-1) primer
Oligo ID:TA005101
Oligo type: Forward Primer Denegeracy: 1
Target: 15318-15343 Tm: 77.3C at salt 1000.0 mMLength: 26
Sequence: CACCGTTTCTACAGGTTAGCTAACGA
(6 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: TA0051 Publication date: 05/04
PMID: 15200815 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): bp
MgCl2: mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 3min>(94C 0.75min>60C 0.75min>72C 0.75min)*45>72C 7min
Buffer: 1.2mM Magnesium sulphate
Polymerase: Platinum Taq (Invitrogen)Cycler:
Note:

Total 9 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.