A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:UM00170
Oligo type: PCR Denegeracy: 1
Target: 18153-18176 Tm: 70.2 C at salt 1000.0mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: UM0017 Publication date: 8/2003
PMID: 12690091 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS Coronavirus Product size (PCR): 189 bp
MgCl2: N/A mM dNTPs: N/A mM Type: RT-PCR
Temp (PCR cycle):45C 30min>95C 3min(95C 10sec>60C 10sec[-1C/cyc]>72C 30sec)*10>(95C 10sec>56C 10sec>72C 30sec)*40
Buffer: Superscript II reverse transcriptase (RT)/platinum Taq pol one-step RT-PCR (InVitrogen)
Polymerase: Platinum Taq polyCycler: N/A
Note: Target range from sequence.



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:UM00170
Oligo type: PCR Denegeracy: 1
Target: 18153-18176 Tm: 70.2 C at salt 1000.0mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: SA0002 Publication date: 12/03
PMID: 15070991 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 109 bp
MgCl2: mM dNTPs: mM Type: Nested RT-PCR
Temp (PCR cycle):
Buffer: PCR amplification master mix
Polymerase: Superscript II/Platinum TaqCycler:
Note: Target range from sequence.



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:UM00170
Oligo type: PCR Denegeracy: 1
Target: 18153-18176 Tm: 70.2 C at salt 1000.0mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: SA0003 Publication date: 12/03
PMID: 15070991 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 190 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: AmpliTaq Gold PCRCycler:
Note: Target range from sequence.



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:UM00170
Oligo type: PCR Denegeracy: 1
Target: 18153-18176 Tm: 70.2 C at salt 1000.0mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: SA0004 Publication date: 12/03
PMID: 15070991 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): bp
MgCl2: mM dNTPs: mM Type: Real-time RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: Cycler:
Note: Target range from sequence.



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:UM00170
Oligo type: PCR Denegeracy: 1
Target: 18153-18176 Tm: 70.2 C at salt 1000.0mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: SG0145 Publication date: 05/05
PMID: 15131175 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS Coronavirus Product size (PCR): 180 bp
MgCl2: mM dNTPs: mM Type: Q-RT-PCR
Temp (PCR cycle):95C 30sec>(95C 5sec>55C 15sec>72C 10sec)*45>40C 30sec
Buffer:
Polymerase: Cycler:
Note: Target range from sequence.



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:SG004105
Oligo type: Forward Primer Denegeracy: 1
Target: 18153-18176 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0041 Publication date: 2003
PMID: 14652014 GI: 30248028 Taxonomy ID:227984
Virus Name: SARS coronavirus Tor2 Product size (PCR): 166 bp
MgCl2: 5 mM dNTPs: 0.2 mM Type: N/A
Temp (PCR cycle):95C 180sec>(95C 10sec>60C 10sec[-1C/Cyc]>72C 20sec)*10>(95C 10sec>56C 10sec>72C 20sec)*40
Buffer: 1x PCR buffer
Polymerase: 0.04U/microL Taq DNA polymerase (Invitrogen)Cycler: MasterCycler (Eppendorf)
Note:



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:SG004105
Oligo type: Forward Primer Denegeracy: 1
Target: 18153-18176 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0091 Publication date: 2003
PMID: 14522061 GI: 3796831 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): bp
MgCl2: 50 mM dNTPs: 0.200 mM Type: Nested PCR
Temp (PCR cycle):95C 180sec>(95C 10sec>60C [+1C/cyc] 10sec>72C 20sec)*10>(95C 10sec> 56C 10sec>72C 20sec)*40
Buffer: 1x PCR buffer (Invirogen)
Polymerase: 2.5U Platinum Taq poly (Invitrogen)Cycler:
Note:



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:SG004105
Oligo type: Forward Primer Denegeracy: 1
Target: 18153-18176 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0123 Publication date: 02/04
PMID: 15030680 GI: 33578015 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 195 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):50C 1800sec>95C 900sec>(95C 10sec>56C 10sec>72C 20sec)*50>72C 420sec
Buffer:
Polymerase: Cycler:
Note:



Oligonucleotide information
Forward(BNIoutS) primer
Oligo ID:SG004701
Oligo type: Forward Primer Denegeracy: 1
Target: 18154-18177 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0047 Publication date: 12/03
PMID: 14699465 GI: 3796831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 195 bp
MgCl2: mM dNTPs: mM Type: Nested RT-PCR
Temp (PCR cycle):61C 1200sec>95C 30sec>(95C 1sec>55C 10sec>72C 8sec)*25
Buffer:
Polymerase: Cycler: LightCycler (Roche)
Note:



Oligonucleotide information
Forward(BNIoutS) primer
Oligo ID:SG004701
Oligo type: Forward Primer Denegeracy: 1
Target: 18154-18177 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0073 Publication date: 01/04
PMID: 15078592 GI: 3796831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 195 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: Cycler:
Note:



Oligonucleotide information
Forward(BNIoutS) primer
Oligo ID:SG004701
Oligo type: Forward Primer Denegeracy: 1
Target: 18154-18177 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0074 Publication date: 03/04
PMID: 15109406 GI: 30698326 Taxonomy ID:258445
Virus Name: SARS coronavirus TW1 Product size (PCR): 195 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):95C 180sec>(95C 10sec>60C 10sec [-1C/cycle]>72C 30sec)*10>(95C 10sec>56C 10sec>72C 30sec)*40
Buffer: 1x buffer
Polymerase: 0.4microL Taq polyCycler:
Note:



Oligonucleotide information
Forward(BNIoutS) primer
Oligo ID:SG004701
Oligo type: Forward Primer Denegeracy: 1
Target: 18154-18177 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0076 Publication date: 02/04
PMID: 15030711 GI: 37960831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 195 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: Cycler:
Note:



Oligonucleotide information
Forward(BNIoutS) primer
Oligo ID:SG004701
Oligo type: Forward Primer Denegeracy: 1
Target: 18154-18177 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0129 Publication date: 10/03
PMID: 14532176 GI: 37960831 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 189 bp
MgCl2: 2.45 mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):45C 1800sec>95C 180sec>(95C 10sec>60C(-1C/cyc) 10sec>72C 30sec)*10>(95C 10sec>56C 10sec>72C 30sec)*40
Buffer: 1x reaction buffer
Polymerase: Cycler:
Note:



Oligonucleotide information
Forward(BNIoutS) primer
Oligo ID:sg004701
Oligo type: Forward Primer Denegeracy: 1
Target: 18154-18177 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0047 Publication date: 12/03
PMID: 14699465 GI: 3796831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 195 bp
MgCl2: mM dNTPs: mM Type: Nested RT-PCR
Temp (PCR cycle):61C 1200sec>95C 30sec>(95C 1sec>55C 10sec>72C 8sec)*25
Buffer:
Polymerase: Cycler: LightCycler (Roche)
Note:



Oligonucleotide information
Forward(BNIoutS) primer
Oligo ID:sg004701
Oligo type: Forward Primer Denegeracy: 1
Target: 18154-18177 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0073 Publication date: 01/04
PMID: 15078592 GI: 3796831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 195 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: Cycler:
Note:



Oligonucleotide information
Forward(BNIoutS) primer
Oligo ID:sg004701
Oligo type: Forward Primer Denegeracy: 1
Target: 18154-18177 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0074 Publication date: 03/04
PMID: 15109406 GI: 30698326 Taxonomy ID:258445
Virus Name: SARS coronavirus TW1 Product size (PCR): 195 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):95C 180sec>(95C 10sec>60C 10sec [-1C/cycle]>72C 30sec)*10>(95C 10sec>56C 10sec>72C 30sec)*40
Buffer: 1x buffer
Polymerase: 0.4microL Taq polyCycler:
Note:



Oligonucleotide information
Forward(BNIoutS) primer
Oligo ID:sg004701
Oligo type: Forward Primer Denegeracy: 1
Target: 18154-18177 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0076 Publication date: 02/04
PMID: 15030711 GI: 37960831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 195 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: Cycler:
Note:



Oligonucleotide information
Forward(BNIoutS) primer
Oligo ID:sg004701
Oligo type: Forward Primer Denegeracy: 1
Target: 18154-18177 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0129 Publication date: 10/03
PMID: 14532176 GI: 37960831 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 189 bp
MgCl2: 2.45 mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):45C 1800sec>95C 180sec>(95C 10sec>60C(-1C/cyc) 10sec>72C 30sec)*10>(95C 10sec>56C 10sec>72C 30sec)*40
Buffer: 1x reaction buffer
Polymerase: Cycler:
Note:



Oligonucleotide information
Forward(BNIoutS) primer
Oligo ID:sg004701
Oligo type: Forward Primer Denegeracy: 1
Target: 18154-18177 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0047 Publication date: 12/03
PMID: 14699465 GI: 3796831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 195 bp
MgCl2: mM dNTPs: mM Type: Nested RT-PCR
Temp (PCR cycle):61C 1200sec>95C 30sec>(95C 1sec>55C 10sec>72C 8sec)*25
Buffer:
Polymerase: Cycler: LightCycler (Roche)
Note:



Oligonucleotide information
Forward(BNIoutS) primer
Oligo ID:sg004701
Oligo type: Forward Primer Denegeracy: 1
Target: 18154-18177 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0073 Publication date: 01/04
PMID: 15078592 GI: 3796831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 195 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: Cycler:
Note:



Oligonucleotide information
Forward(BNIoutS) primer
Oligo ID:sg004701
Oligo type: Forward Primer Denegeracy: 1
Target: 18154-18177 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0074 Publication date: 03/04
PMID: 15109406 GI: 30698326 Taxonomy ID:258445
Virus Name: SARS coronavirus TW1 Product size (PCR): 195 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):95C 180sec>(95C 10sec>60C 10sec [-1C/cycle]>72C 30sec)*10>(95C 10sec>56C 10sec>72C 30sec)*40
Buffer: 1x buffer
Polymerase: 0.4microL Taq polyCycler:
Note:



Oligonucleotide information
Forward(BNIoutS) primer
Oligo ID:sg004701
Oligo type: Forward Primer Denegeracy: 1
Target: 18154-18177 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0076 Publication date: 02/04
PMID: 15030711 GI: 37960831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 195 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: Cycler:
Note:



Oligonucleotide information
Forward(BNIoutS) primer
Oligo ID:sg004701
Oligo type: Forward Primer Denegeracy: 1
Target: 18154-18177 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0129 Publication date: 10/03
PMID: 14532176 GI: 37960831 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 189 bp
MgCl2: 2.45 mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):45C 1800sec>95C 180sec>(95C 10sec>60C(-1C/cyc) 10sec>72C 30sec)*10>(95C 10sec>56C 10sec>72C 30sec)*40
Buffer: 1x reaction buffer
Polymerase: Cycler:
Note:



Oligonucleotide information
Forward(BNIoutS) primer
Oligo ID:sg004701
Oligo type: Forward Primer Denegeracy: 1
Target: 18154-18177 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0047 Publication date: 12/03
PMID: 14699465 GI: 3796831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 195 bp
MgCl2: mM dNTPs: mM Type: Nested RT-PCR
Temp (PCR cycle):61C 1200sec>95C 30sec>(95C 1sec>55C 10sec>72C 8sec)*25
Buffer:
Polymerase: Cycler: LightCycler (Roche)
Note:



Oligonucleotide information
Forward(BNIoutS) primer
Oligo ID:sg004701
Oligo type: Forward Primer Denegeracy: 1
Target: 18154-18177 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0073 Publication date: 01/04
PMID: 15078592 GI: 3796831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 195 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: Cycler:
Note:



Oligonucleotide information
Forward(BNIoutS) primer
Oligo ID:sg004701
Oligo type: Forward Primer Denegeracy: 1
Target: 18154-18177 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0074 Publication date: 03/04
PMID: 15109406 GI: 30698326 Taxonomy ID:258445
Virus Name: SARS coronavirus TW1 Product size (PCR): 195 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):95C 180sec>(95C 10sec>60C 10sec [-1C/cycle]>72C 30sec)*10>(95C 10sec>56C 10sec>72C 30sec)*40
Buffer: 1x buffer
Polymerase: 0.4microL Taq polyCycler:
Note:



Oligonucleotide information
Forward(BNIoutS) primer
Oligo ID:sg004701
Oligo type: Forward Primer Denegeracy: 1
Target: 18154-18177 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0076 Publication date: 02/04
PMID: 15030711 GI: 37960831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 195 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: Cycler:
Note:



Oligonucleotide information
Forward(BNIoutS) primer
Oligo ID:sg004701
Oligo type: Forward Primer Denegeracy: 1
Target: 18154-18177 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0129 Publication date: 10/03
PMID: 14532176 GI: 37960831 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 189 bp
MgCl2: 2.45 mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):45C 1800sec>95C 180sec>(95C 10sec>60C(-1C/cyc) 10sec>72C 30sec)*10>(95C 10sec>56C 10sec>72C 30sec)*40
Buffer: 1x reaction buffer
Polymerase: Cycler:
Note:



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:SG004105
Oligo type: Forward Primer Denegeracy: 1
Target: 18153-18176 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0041 Publication date: 2003
PMID: 14652014 GI: 30248028 Taxonomy ID:227984
Virus Name: SARS coronavirus Tor2 Product size (PCR): 166 bp
MgCl2: 5 mM dNTPs: 0.2 mM Type: N/A
Temp (PCR cycle):95C 180sec>(95C 10sec>60C 10sec[-1C/Cyc]>72C 20sec)*10>(95C 10sec>56C 10sec>72C 20sec)*40
Buffer: 1x PCR buffer
Polymerase: 0.04U/microL Taq DNA polymerase (Invitrogen)Cycler: MasterCycler (Eppendorf)
Note:



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:SG004105
Oligo type: Forward Primer Denegeracy: 1
Target: 18153-18176 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0091 Publication date: 2003
PMID: 14522061 GI: 3796831 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): bp
MgCl2: 50 mM dNTPs: 0.200 mM Type: Nested PCR
Temp (PCR cycle):95C 180sec>(95C 10sec>60C [+1C/cyc] 10sec>72C 20sec)*10>(95C 10sec> 56C 10sec>72C 20sec)*40
Buffer: 1x PCR buffer (Invirogen)
Polymerase: 2.5U Platinum Taq poly (Invitrogen)Cycler:
Note:



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:SG004105
Oligo type: Forward Primer Denegeracy: 1
Target: 18153-18176 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0123 Publication date: 02/04
PMID: 15030680 GI: 33578015 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 195 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):50C 1800sec>95C 900sec>(95C 10sec>56C 10sec>72C 20sec)*50>72C 420sec
Buffer:
Polymerase: Cycler:
Note:



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:SG004105
Oligo type: Forward Primer Denegeracy: 1
Target: 18153-18176 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0041 Publication date: 2003
PMID: 14652014 GI: 30248028 Taxonomy ID:227984
Virus Name: SARS coronavirus Tor2 Product size (PCR): 166 bp
MgCl2: 5 mM dNTPs: 0.2 mM Type: N/A
Temp (PCR cycle):95C 180sec>(95C 10sec>60C 10sec[-1C/Cyc]>72C 20sec)*10>(95C 10sec>56C 10sec>72C 20sec)*40
Buffer: 1x PCR buffer
Polymerase: 0.04U/microL Taq DNA polymerase (Invitrogen)Cycler: MasterCycler (Eppendorf)
Note:



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:SG004105
Oligo type: Forward Primer Denegeracy: 1
Target: 18153-18176 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0091 Publication date: 2003
PMID: 14522061 GI: 3796831 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): bp
MgCl2: 50 mM dNTPs: 0.200 mM Type: Nested PCR
Temp (PCR cycle):95C 180sec>(95C 10sec>60C [+1C/cyc] 10sec>72C 20sec)*10>(95C 10sec> 56C 10sec>72C 20sec)*40
Buffer: 1x PCR buffer (Invirogen)
Polymerase: 2.5U Platinum Taq poly (Invitrogen)Cycler:
Note:



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:SG004105
Oligo type: Forward Primer Denegeracy: 1
Target: 18153-18176 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0123 Publication date: 02/04
PMID: 15030680 GI: 33578015 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 195 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):50C 1800sec>95C 900sec>(95C 10sec>56C 10sec>72C 20sec)*50>72C 420sec
Buffer:
Polymerase: Cycler:
Note:



Oligonucleotide information
Forward(BNIoutS) primer
Oligo ID:sg004701
Oligo type: Forward Primer Denegeracy: 1
Target: 18154-18177 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0047 Publication date: 12/03
PMID: 14699465 GI: 3796831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 195 bp
MgCl2: mM dNTPs: mM Type: Nested RT-PCR
Temp (PCR cycle):61C 1200sec>95C 30sec>(95C 1sec>55C 10sec>72C 8sec)*25
Buffer:
Polymerase: Cycler: LightCycler (Roche)
Note:



Oligonucleotide information
Forward(BNIoutS) primer
Oligo ID:sg004701
Oligo type: Forward Primer Denegeracy: 1
Target: 18154-18177 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0073 Publication date: 01/04
PMID: 15078592 GI: 3796831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 195 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: Cycler:
Note:



Oligonucleotide information
Forward(BNIoutS) primer
Oligo ID:sg004701
Oligo type: Forward Primer Denegeracy: 1
Target: 18154-18177 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0074 Publication date: 03/04
PMID: 15109406 GI: 30698326 Taxonomy ID:258445
Virus Name: SARS coronavirus TW1 Product size (PCR): 195 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):95C 180sec>(95C 10sec>60C 10sec [-1C/cycle]>72C 30sec)*10>(95C 10sec>56C 10sec>72C 30sec)*40
Buffer: 1x buffer
Polymerase: 0.4microL Taq polyCycler:
Note:



Oligonucleotide information
Forward(BNIoutS) primer
Oligo ID:sg004701
Oligo type: Forward Primer Denegeracy: 1
Target: 18154-18177 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0076 Publication date: 02/04
PMID: 15030711 GI: 37960831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 195 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: Cycler:
Note:



Oligonucleotide information
Forward(BNIoutS) primer
Oligo ID:sg004701
Oligo type: Forward Primer Denegeracy: 1
Target: 18154-18177 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0129 Publication date: 10/03
PMID: 14532176 GI: 37960831 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 189 bp
MgCl2: 2.45 mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):45C 1800sec>95C 180sec>(95C 10sec>60C(-1C/cyc) 10sec>72C 30sec)*10>(95C 10sec>56C 10sec>72C 30sec)*40
Buffer: 1x reaction buffer
Polymerase: Cycler:
Note:



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:UM00170
Oligo type: PCR Denegeracy: 1
Target: 18153-18176 Tm: 70.2 C at salt 1000.0mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: UM0017 Publication date: 8/2003
PMID: 12690091 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS Coronavirus Product size (PCR): 189 bp
MgCl2: N/A mM dNTPs: N/A mM Type: RT-PCR
Temp (PCR cycle):45C 30min>95C 3min(95C 10sec>60C 10sec[-1C/cyc]>72C 30sec)*10>(95C 10sec>56C 10sec>72C 30sec)*40
Buffer: Superscript II reverse transcriptase (RT)/platinum Taq pol one-step RT-PCR (InVitrogen)
Polymerase: Platinum Taq polyCycler: N/A
Note: Target range from sequence.



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:UM00170
Oligo type: PCR Denegeracy: 1
Target: 18153-18176 Tm: 70.2 C at salt 1000.0mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: SA0002 Publication date: 12/03
PMID: 15070991 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 109 bp
MgCl2: mM dNTPs: mM Type: Nested RT-PCR
Temp (PCR cycle):
Buffer: PCR amplification master mix
Polymerase: Superscript II/Platinum TaqCycler:
Note: Target range from sequence.



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:UM00170
Oligo type: PCR Denegeracy: 1
Target: 18153-18176 Tm: 70.2 C at salt 1000.0mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: SA0003 Publication date: 12/03
PMID: 15070991 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 190 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: AmpliTaq Gold PCRCycler:
Note: Target range from sequence.



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:UM00170
Oligo type: PCR Denegeracy: 1
Target: 18153-18176 Tm: 70.2 C at salt 1000.0mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: SA0004 Publication date: 12/03
PMID: 15070991 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): bp
MgCl2: mM dNTPs: mM Type: Real-time RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: Cycler:
Note: Target range from sequence.



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:UM00170
Oligo type: PCR Denegeracy: 1
Target: 18153-18176 Tm: 70.2 C at salt 1000.0mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: SG0145 Publication date: 05/05
PMID: 15131175 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS Coronavirus Product size (PCR): 180 bp
MgCl2: mM dNTPs: mM Type: Q-RT-PCR
Temp (PCR cycle):95C 30sec>(95C 5sec>55C 15sec>72C 10sec)*45>40C 30sec
Buffer:
Polymerase: Cycler:
Note: Target range from sequence.



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:UM00170
Oligo type: PCR Denegeracy: 1
Target: 18153-18176 Tm: 70.2 C at salt 1000.0mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: UM0017 Publication date: 8/2003
PMID: 12690091 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS Coronavirus Product size (PCR): 189 bp
MgCl2: N/A mM dNTPs: N/A mM Type: RT-PCR
Temp (PCR cycle):45C 30min>95C 3min(95C 10sec>60C 10sec[-1C/cyc]>72C 30sec)*10>(95C 10sec>56C 10sec>72C 30sec)*40
Buffer: Superscript II reverse transcriptase (RT)/platinum Taq pol one-step RT-PCR (InVitrogen)
Polymerase: Platinum Taq polyCycler: N/A
Note: Target range from sequence.



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:UM00170
Oligo type: PCR Denegeracy: 1
Target: 18153-18176 Tm: 70.2 C at salt 1000.0mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: SA0002 Publication date: 12/03
PMID: 15070991 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 109 bp
MgCl2: mM dNTPs: mM Type: Nested RT-PCR
Temp (PCR cycle):
Buffer: PCR amplification master mix
Polymerase: Superscript II/Platinum TaqCycler:
Note: Target range from sequence.



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:UM00170
Oligo type: PCR Denegeracy: 1
Target: 18153-18176 Tm: 70.2 C at salt 1000.0mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: SA0003 Publication date: 12/03
PMID: 15070991 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 190 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: AmpliTaq Gold PCRCycler:
Note: Target range from sequence.



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:UM00170
Oligo type: PCR Denegeracy: 1
Target: 18153-18176 Tm: 70.2 C at salt 1000.0mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: SA0004 Publication date: 12/03
PMID: 15070991 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): bp
MgCl2: mM dNTPs: mM Type: Real-time RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: Cycler:
Note: Target range from sequence.



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:UM00170
Oligo type: PCR Denegeracy: 1
Target: 18153-18176 Tm: 70.2 C at salt 1000.0mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: SG0145 Publication date: 05/05
PMID: 15131175 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS Coronavirus Product size (PCR): 180 bp
MgCl2: mM dNTPs: mM Type: Q-RT-PCR
Temp (PCR cycle):95C 30sec>(95C 5sec>55C 15sec>72C 10sec)*45>40C 30sec
Buffer:
Polymerase: Cycler:
Note: Target range from sequence.



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:UM00170
Oligo type: PCR Denegeracy: 1
Target: 18153-18176 Tm: 70.2 C at salt 1000.0mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: UM0017 Publication date: 8/2003
PMID: 12690091 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS Coronavirus Product size (PCR): 189 bp
MgCl2: N/A mM dNTPs: N/A mM Type: RT-PCR
Temp (PCR cycle):45C 30min>95C 3min(95C 10sec>60C 10sec[-1C/cyc]>72C 30sec)*10>(95C 10sec>56C 10sec>72C 30sec)*40
Buffer: Superscript II reverse transcriptase (RT)/platinum Taq pol one-step RT-PCR (InVitrogen)
Polymerase: Platinum Taq polyCycler: N/A
Note: Target range from sequence.



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:UM00170
Oligo type: PCR Denegeracy: 1
Target: 18153-18176 Tm: 70.2 C at salt 1000.0mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: SA0002 Publication date: 12/03
PMID: 15070991 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 109 bp
MgCl2: mM dNTPs: mM Type: Nested RT-PCR
Temp (PCR cycle):
Buffer: PCR amplification master mix
Polymerase: Superscript II/Platinum TaqCycler:
Note: Target range from sequence.



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:UM00170
Oligo type: PCR Denegeracy: 1
Target: 18153-18176 Tm: 70.2 C at salt 1000.0mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: SA0003 Publication date: 12/03
PMID: 15070991 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 190 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: AmpliTaq Gold PCRCycler:
Note: Target range from sequence.



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:UM00170
Oligo type: PCR Denegeracy: 1
Target: 18153-18176 Tm: 70.2 C at salt 1000.0mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: SA0004 Publication date: 12/03
PMID: 15070991 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): bp
MgCl2: mM dNTPs: mM Type: Real-time RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: Cycler:
Note: Target range from sequence.



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:UM00170
Oligo type: PCR Denegeracy: 1
Target: 18153-18176 Tm: 70.2 C at salt 1000.0mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: SG0145 Publication date: 05/05
PMID: 15131175 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS Coronavirus Product size (PCR): 180 bp
MgCl2: mM dNTPs: mM Type: Q-RT-PCR
Temp (PCR cycle):95C 30sec>(95C 5sec>55C 15sec>72C 10sec)*45>40C 30sec
Buffer:
Polymerase: Cycler:
Note: Target range from sequence.



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:um00170
Oligo type: PCR Denegeracy: 1
Target: 18153-18176 Tm: 70.2 C at salt 1000.0mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: UM0017 Publication date: 8/2003
PMID: 12690091 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS Coronavirus Product size (PCR): 189 bp
MgCl2: N/A mM dNTPs: N/A mM Type: RT-PCR
Temp (PCR cycle):45C 30min>95C 3min(95C 10sec>60C 10sec[-1C/cyc]>72C 30sec)*10>(95C 10sec>56C 10sec>72C 30sec)*40
Buffer: Superscript II reverse transcriptase (RT)/platinum Taq pol one-step RT-PCR (InVitrogen)
Polymerase: Platinum Taq polyCycler: N/A
Note: Target range from sequence.



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:um00170
Oligo type: PCR Denegeracy: 1
Target: 18153-18176 Tm: 70.2 C at salt 1000.0mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: SA0002 Publication date: 12/03
PMID: 15070991 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 109 bp
MgCl2: mM dNTPs: mM Type: Nested RT-PCR
Temp (PCR cycle):
Buffer: PCR amplification master mix
Polymerase: Superscript II/Platinum TaqCycler:
Note: Target range from sequence.



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:um00170
Oligo type: PCR Denegeracy: 1
Target: 18153-18176 Tm: 70.2 C at salt 1000.0mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: SA0003 Publication date: 12/03
PMID: 15070991 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 190 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: AmpliTaq Gold PCRCycler:
Note: Target range from sequence.



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:um00170
Oligo type: PCR Denegeracy: 1
Target: 18153-18176 Tm: 70.2 C at salt 1000.0mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: SA0004 Publication date: 12/03
PMID: 15070991 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): bp
MgCl2: mM dNTPs: mM Type: Real-time RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: Cycler:
Note: Target range from sequence.



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:um00170
Oligo type: PCR Denegeracy: 1
Target: 18153-18176 Tm: 70.2 C at salt 1000.0mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: SG0145 Publication date: 05/05
PMID: 15131175 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS Coronavirus Product size (PCR): 180 bp
MgCl2: mM dNTPs: mM Type: Q-RT-PCR
Temp (PCR cycle):95C 30sec>(95C 5sec>55C 15sec>72C 10sec)*45>40C 30sec
Buffer:
Polymerase: Cycler:
Note: Target range from sequence.



Oligonucleotide information
Forward(BNIout-sense) primer
Oligo ID:TA005901
Oligo type: Forward Primer Denegeracy: 1
Target: 18154-18177 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: TA0059 Publication date: 5/04
PMID: 15131154 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 195 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):94C 2min>(94C 30sec>54C 30sec>72C 30sec)*34>72C 10min
Buffer:
Polymerase: Cycler:
Note:

Total 60 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.